Insertion sequence, IS1 ir Transposase geneR 5 GGTGATGCTGCCAACTTACTGAT 3 53
16
Phase Variation in Salmonella h antigens H1 gene S H2 gene H1 H2 flagella flagella
Phase Variation in Salmonella H Antigens H1 gene IS H2 gene H1 flagella H2 flagella
Types of Transposable Genetic Elements Transposons(Tn) Definition: Elements that carry other genes in addition to those involved in transposition, gene that moves from one dna molecule to another within the same cell or from one site on a dna molecule to another site on the same molecule Nomenclature-Tn10 Structure Bacterial composite transpos on Genes for Composite Tns Inverted transposition Structural genes mportance Antibiotic resistance Inverted is Integration
Types of Transposable Genetic Elements • Transposons (Tn) – Definition: Elements that carry other genes in addition to those involved in transposition, gene that moves from one DNA molecule to another within the same cell or from one site on a DNA molecule to another site on the same molecule – Nomenclature - Tn10 – Structure • Composite Tns – Importance • Antibiotic resistance Integration
Transposable element Copying and: Copy of trans Insertion posable element Gene F interrupted and no longer functional Transposon Transposable element Other: Transposable genes element
Transposon tn10 9,300bp 1400 1,400 6,500bp bp IS10L IS10R Tetracycline resistance Inverted gene(tcR) Inverted repeats repeats of is of is element element Inverted is elements
20