Intragenic(a)Themutagenproflavincaninsertbetweentwobasepairs.suppression ofNH2H2NMoleculeofproflavininsertedbetweenstackedbasepairsrlB mutationsProflavin(b)Consequencesofexposuretoproflavin.IntragenicrllB+wild-typeExposuretoproflavinsuppression:FCOrllB-ExposuretoproflavinThe restoration ofFCOFC7rllB*revertantgene function by oneOriginalSecondmutationmutationmutation canceling(c)rllB*revertantXwildtypeyieldsrllB-recombinants.another in the sameFCOFC7gene.rllB-rllBFCOFC78-11Fig.8.5
8-11 Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display Intragenic suppression of rIIB mutations Fig. 8.5 Intragenic Intragenic suppression suppression: The restoration of The restoration of gene function by one gene function by one mutation canceling mutation canceling another in the same another in the same gene
(d)Different sets ofmutations generate either a mutantoranormalphenotypeProflavin-inducedmutationsPhenotype(+)insertion(-)deletionMutantor+Mutantor++orMutantor++++or+++++Wildtype+ororWildtype+++or++++++8-12Fig.8.5
8-12 Fig. 8.5 Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display
correcttripletincorrecttripletInterpretation:(a)Intragenic suppression:2mutations ofoppositesign.Singlebase insertion(+)and singlebasedeletion()Each gene has a singleATG AAC AAT GCGCCG GAGGAA GCG GACstarting point whichATG AAC AATCGCGCCG GAG GAGCGGACestablishes a reading(b)Intragenicsuppression:3mutationsofthesamesign.frame.Threesinglebasedeletions(ATG AAC AAT GCG CCG GAG GAA GCGGACFrameshift mutations:ATGAACAAGCGCGGGGAAGCG GACInsertions ordeletions ofbase pairs that alter theThree singlebase insertions(+grouping of nucleotidesATG AAC AAT GCGCCGGAGGAA GCGGACinto codons.ATG AAC AAT GGCGCTCGGCAGGAA GCGGACAcodonis composed of(c)Someframeshiftmutations.Singlebasedeletion (一)three nucleotides.ATG AAC AAT GCGCCG GAG GAA GCG GACMost amino acids areATG AAC AAGCG CCG GAG GAA GCG GACspecified by more thanSinglebaseinsertion(+)one codonATG AAC AATGCGCCG GAGGAAGCG GACFig.8.6ATG AAC AAT GGCGCCG GAG GAA GCG GAC
8-13 Fig. 8.6 Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display Interpretation: Each gene has a single Each gene has a single starting point which starting point which establishes a establishes a reading reading frame. Frameshift Frameshift mutations mutations: Insertions or deletions of Insertions or deletions of base pairs that alter the base pairs that alter the grouping of nucleotides grouping of nucleotides into codons. A codon is composed of is composed of three nucleotides. three nucleotides. Most amino acids are Most amino acids are specified by more than specified by more than one codon
Cracking the code: Which codons representwhich amino acids?In1950s,thediscoveryofmessengerRNAsDNAmolecules formRNATranscription,transporting geneticCinformation.MaturemRNANucleusProtein synthesis takesRNATransport to cytoplasm forplace in cytoplasm deducedproteinsynthesis(translationfromradioactive tagging ofmRNAamino acids.Cellmembrane8-14
8-14 Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display Cracking the code: Which Cracking the code: Which codons represent represent which amino acids? which amino acids? In 1950s, the discovery of In 1950s, the discovery of messenger messenger RNAs, molecules for molecules for transporting genetic transporting genetic information. information. Protein synthesis takes Protein synthesis takes place in cytoplasm deduced place in cytoplasm deduced from radioactive tagging of from radioactive tagging of amino acids. amino acids
The development of two techniquesIn vitro translation systemsSynthesis of artificial mRNAsC8-15
8-15 Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display The development of two techniques The development of two techniques In vitro In vitro translation systems translation systems Synthesis of artificial mRNAs Synthesis of artificial mRNAs