Modifications to DNADNA is modified Cresidues nexttoGresidues aremethylated(mammals)NH2About 80% of CG sequences modified in this way Methyl group projects out into major groove- harder for DNA binding proteins to bind sequence5-Methylcytosineresidue CpG islands (C-phosphate-G)Clusters of CpG sequence located near gene promoters These are typically unmethylatedMore ready access for transcription Methylation is way to silence DNA containing no genes
Modifications to DNA ◼ DNA is modified C residues next to G residues are methylated (mammals) • About 80% of CG sequences modified in this way Methyl group projects out into major groove – harder for DNA binding proteins to bind sequence CpG islands (C-phosphate-G) • Clusters of CpG sequence located near gene promoters • These are typically unmethylated • More ready access for transcription Methylation is way to silence DNA containing no genes
Binding of RNA Polymerase to Template DNA·RNA polymerase holoenzyme and thepromoter form a closed promotermigtationsotcoenoticomplex.p2: RNA polymerase holoenzyme unwindsabout 14 base pairs of DNA forming theodprnnvery stable open promoter complex国: The transcript start site on the templatep3strand is usually a pyrimidine, so mosttranscripts begin with a purineSpeP
Binding of RNA Polymerase to Template DNA • RNA polymerase holoenzyme and the promoter form a closed promoter complex. • RNA polymerase holoenzyme unwinds about 14 base pairs of DNA forming the very stable open promoter complex. • The transcript start site on the template strand is usually a pyrimidine, so most transcripts begin with a purine
RNAPolymerase,sigmafactorRNA Polymerase is large molecular machine Core enzyme (prokaryotes).α, α, β,β', HoloenzymeCore enzyme + sigma (o) factorHoloenzymeCoreenzyme+sigma (o)factorDNACoreenzymeHoloenzyme
RNA Polymerase, sigma factor ◼ RNA Polymerase is large molecular machine Core enzyme (prokaryotes) • α, α, β, β’, ω Holoenzyme • Core enzyme + sigma (σ) factor
RNAPolymerase,sigmafactorWhere on DNA to bind? sigma (o) factor Smaller protein Guides RNA polymerase to target DNA sequenceBinds to Promoter-10 region (TATA box) & -35 region Firstleveloftranscriptional controlTxnstartsiteStrongE,colipromoterstyrtRNAtmD1GATCAmX1m(DXEmErnAtrmA2TAfdvm
RNA Polymerase, sigma factor ◼ Where on DNA to bind? sigma (σ) factor • Smaller protein • Guides RNA polymerase to target DNA sequence • Binds to Promoter • -10 region (TATA box) & -35 region First level of transcriptional control
Consensus sequence elements in the prokaryotic promoter. Within the promoter are two consensus sequence elements.·Pribnowbox near-1o,whose consensus sequence is the hexameric TATAAT, and asequence in the-35 region containingthe hexameric consensus TTGACAGene35 regionPribnowboxInitiation(10 region)site (+1)anaBADGGATCCTACCTGACGCTTATTTAACCCGTTTTaracGCCGTGAbioAbioBgalP2laladnAmDIEIRNATYEtrpAAATGAGGTTGACAATTAGTACGCAAGTTCACGTAAAAAAInorderfortranscriptiontobegin,theDNAduplexmust be“openedTheeficiency ofinitiatioris proportional to the melting temperature, Tm, in the Pribnow box, suggesting that the AT-richnatureofthisregionissuitedforeasymeltingoftheDNAduplexandcreationoftheopenpromotercomplex
Consensus sequence elements in the prokaryotic promoter • Within the promoter are two consensus sequence elements. • Pribnow box near -10, whose consensus sequence is the hexameric TATAAT, and a sequence in the -35 region containing the hexameric consensus TTGACA In order for transcription to begin, the DNA duplex must be “opened”. The efficiency of initiation is proportional to the melting temperature, Tm, in the Pribnow box, suggesting that the AT-rich nature of this region is suited for easy “melting” of the DNA duplex and creation of the open promoter complex