Epigenetics: Factors that affact the proteome of a cell Physiology Interactions Temperature Pharmaceutical substances Proteome Stress Cell-specific Culture gene expression conditions Genome 0/27/2005 Chaoqun Wu, Fudan University
10/27/2005 Chaoqun Wu, Fudan University Chaoqun Wu, Fudan University 26 Epigenetics: Factors that affact the proteome of a cell
Levels of genome research in eukaryotes Change in paradigm of Life Sciences Moving from targeted investigations of few genes to the investigation of mamy (all)genes in untargeted experiments that Nucleus use highly parallel approaches in order to identify unknown genes DNA (Structural Genomics) pre-mRNA Cytoplasm TCGCACAGGCATGGGGTCTCCGACTTCTT mRNA mRNA Transcriptomics) Protein (Proteomics) (unctional Genomics) Metabolites ( Metabolomics) =Looking for the unexpected 0/27/2005 Chaoqun Wu, Fudan University
10/27/2005 Chaoqun Wu, Fudan University Chaoqun Wu, Fudan University 27 Levels of genome research in eukaryotes
Why studying proteomes Genome DNA 7 ranscrpptome primary RNA→mRNA transcript Proteome K mature》 Active primary protein product protein protein Proteomic is afunctional approach degradation 0/27/2005 Chaoqun Wu, Fudan University
10/27/2005 Chaoqun Wu, Fudan University Chaoqun Wu, Fudan University 28 mRNA primary pro primary protein product product protein degradation degradation « mature » protein Active protein protein Transcriptome Transcriptome primary R primary RNA transcript transcript DNA Genome Why studying proteomes ? Why studying proteomes ? Proteome Proteome Proteomic is a functional approach Proteomic is a functional approach
mportance of proteins I they serve as catalysts that maintain metabolic processes in the cell they serve as structural elements both within and outside the cell they are signals secreted by one cell or deposited in the extracellular matrix that are recognized by other cells I they are receptors that convey information about the extracellular milieu to the cell they serve as intracellular signaling components that mediate the effects of receptors 0/27/2005 Chaoqun Wu, Fudan University
10/27/2005 Chaoqun Wu, Fudan University Chaoqun Wu, Fudan University 29 Importance of Proteins: Importance of Proteins: they serve as catalysts that maintain metabolic they serve as catalysts that maintain metabolic processes in the cell, processes in the cell, they serve as structural elements both within and they serve as structural elements both within and outside the cell, outside the cell, they are signals secreted by one cell or deposited they are signals secreted by one cell or deposited in the extracellular extracellular matrix that are recognized by matrix that are recognized by other cells, other cells, they are receptors that convey information about they are receptors that convey information about the extracellular extracellular milieu to the cell, milieu to the cell, they serve as intracellular signaling components they serve as intracellular signaling components that mediate the effects of receptors. that mediate the effects of receptors
Importance of Proteins they are key components of the machinery that determines which genes are expressed and whether mRNAs are translated into proteins a they are involved in manipulation of dNa and RNA through processes such as: DNA replication DNA recombination, RNA splicing or editing http://ww-users.medcornelledu/-jawagne/proteins&purification.html 0/27/2005 Chaoqun Wu, Fudan University
10/27/2005 Chaoqun Wu, Fudan University Chaoqun Wu, Fudan University 30 Importance of Proteins: they are key components of the machinery that determines which genes are expressed and whether mRNAs are translated into proteins, they are involved in manipulation of DNA and RNA through processes such as: DNA replication, DNA recombination, RNA splicing or editing. http://www-users.med.cornell.edu/~jawagne/proteins_&_purification.html