Four separate reaction mixture as shown above for C(p miners each nucleotide are attached to C G dye-label of T, different color L儿L Th The products of the four reactions are sequence m information ed and all dye- 人A人A is fed to a labeled segments are DNA applied to a single computer. migration lane of the gel. 。人人人从 ATAGCTGTTTCTGCAGTGCC Detector Laser beam
Chemical Cleavage method Not used as frequently as Sanger's Start with ssdna labelled with p-32 at one end Strand is cleaved by chemical reagents Assumption is that strands of all possible lengths, each cleaved at just one of the occurrences of a given base, will be produced. Fragments are electrophoresed and sequence is read
Chemical Cleavage Method Not used as frequently as Sanger's • Start with ssDNA labelled with P-32 at one end • Strand is cleaved by chemical reagents • Assumption is that strands of all possible lengths, each cleaved at just one of the occurrences of a given base, will be produced. • Fragments are electrophoresed and sequence is read
Chemical cleavage Method Four reactions are used G-specific cleavage with dimethyl sulfate followed by strand scission with piperidine G/A cleavage: depurination with mild acid, followed by piperidine C/T cleavage: ring hydrolysis by hydrazine, followed by piperidine C cleavage: same method(hydrazine and piperidine), but high salt protects T residues
Chemical Cleavage Method Four reactions are used • G-specific cleavage with dimethyl sulfate, followed by strand scission with piperidine • G/A cleavage: depurination with mild acid, followed by piperidine • C/T cleavage: ring hydrolysis by hydrazine, followed by piperidine • C cleavage: same method (hydrazine and piperidine), but high salt protects T residues
32PGCTACGTA specific chemical cleavage GG+A T+CC
32pGCTACGTA G G+A T+C C specific chemical cleavage
G A+G C+T C ATcTGAcccTAGTcc 5 32R-TCCTGATCCCAGTCTA 3 5 ATCTGACCCTAGTCCT-32pie