tRNA Synthetase The Met charged on tRNAMMet H O H3N-C-C-0-tRNA (by Met-tRNA synthetase)is specifically formylated b y CH the action of transformylase CH Methionyl-tRNA to form fMet-tRNafMet (Met-tRNA4 N-formyl in bacteria tetrahydrofolate Transformylase Tetrahydrofolate NO-Formyltetrahydrofolate HH O provides the formyl group C-N-C-C-O-tRNAL CH CHa Formylmethionyl-tRNA (fMet-tRNA4
The Met charged on tRNAfMet (by Met-tRNA synthetase) is specifically formylated by the action of transformylase to form fMet-tRNAfMet in bacteria; N10 -Formyltetrahydrofolate provides the formyl group;
21. The Shine-Dalgarno sequence and a nearby aUG marks the start site of translation on a bacterial rNA Sequence comparison of the initiator region of all bacterial mRNAs revealed that a purine-rich sequence called Shine-Dalgarno sequence is located about 10 nucleotides upstream the initiating AUG (or rarely GUG in bacteria) codon This purine-rich sequence was found to be complementary to a pyrimidine-rich sequence at the 3end of the 16s rrNa present in the 30S subunit of the ribosomes The shine-Dalgarno sequence may thus serve as the ribosome binding site on bacterial mRNAS
21. The Shine-Dalgarno sequence and a nearby AUG marks the start site of translation on a bacterial mRNA • Sequence comparison of the initiator region of all bacterial mRNAs revealed that a purine-rich sequence called Shine-Dalgarno sequence is located about 10 nucleotides upstream the initiating AUG (or rarely GUG in bacteria) codon; • This purine-rich sequence was found to be complementary to a pyrimidine-rich sequence at the 3`end of the 16S rRNA present in the 30S subunit of the ribosomes. • The Shine-Dalgarno sequence may thus serve as the ribosome binding site on bacterial mRNAs
.colitrpA(5AGCACGAGGGGAAAUCUGAU C() E. coliaraB UUUGGA UGGAGUGAAACGAUGGCGAUUGCA E coli lacI CAAUUCAGGGUGGUG A UGUGAAACCAGUA X174 phage A protein A A UCUUGGAGGCUUUUUUAUGGUUCGUUCU A phage cro A UGUACUAAGGAGGUUGUAUGGAACAACGC Shine-Dalgarno sequence; Initiation codon: pairs with 16s rRNA pairs with fMet-tRNAMet OH 3’ End of 16SrRNA A GAUC U UCCUCC叠 N Idealized () A UUCCUAGGAGGUUUGACCUAUGCGAGCUUUUAGUG karyote mRNA purine-rich Shine-Dalgarno sequence and a aUg codon marks the start site of polypeptide synthesis on bacterial mrNa molecules
A purine-rich Shine-Dalgarno sequence and a AUG codon marks the start site of polypeptide synthesis on bacterial mRNA molecules. Translation start codon RBS
22. Aided by initiation factors, the mrNA the fMet-tRNa Met and the ribosome assemble to form an initiation complex The 16s rrna directs the 3os subunit of to the initiation site of the mrNa(through base pairing) iF3 binds to the 30S subunit to prevent its premature association with the 5os subunit I F2 (with GtP bound )then helps the fMet-tRNatMet to enter the P(peptidyl) site on the 30S subunit where the initiation codon is located (no other aminoacyl-trNa can enter the P site!) The joining of the 50S subunit releases all the initiation factors and forms the initiation complex
22. Aided by initiation factors, the mRNA, the fMet-tRNAfMet and the ribosome assemble to form an initiation complex • The 16S rRNA directs the 30S subunit of to the initiation site of the mRNA (through base pairing). • IF3 binds to the 30S subunit to prevent its premature association with the 50S subunit. • IF2 (with GTP bound) then helps the fMet-tRNAfMet to enter the P (peptidyl) site on the 30S subunit where the initiation codon is located (no other aminoacyl-tRNA can enter the P site!). • The joining of the 50S subunit releases all the initiation factors and forms the initiation complex
IF-1 5 oEe Subunit mRNA 50S Subunit. LE UAC ① Initiation mRNA codon 5 AUG 3 AUG IF-3 P A Next codon GTP The initiating complex is assembled RNA from the small subunit of the 3 UAC 5 OIF-2/GTP anticodon UAC ibosome, the mRNA, the initiating lUGI IF P IF. aminoacyl-tRNA (being fMet-tRNA Met in bacteria), and the GDP+ P large subunit of the ribosome +(IF2+1F3
The initiating complex is assembled from the small subunit of the ribosome, the mRNA, the initiating aminoacyl-tRNA (being fMet-tRNAfMet in bacteria), and the large subunit of the ribosome