Force-induced decline of TEA domain family member 1 contributes to osteoclastogenesis via regulation of Osteoprotegerin.pdf

Archives of Oral Biology 100(2019)23-32 Contents lists available at ScienceDirect Archives of Oral Biology ELSEVIER journalhomepagewww.elsevier.com/locate/archoralbio Force-induced decline of tea domain family member 1 contributes to osteoclastogenesis via regulation of osteoprotegerin Qian Li, Gaofeng Han, Dawei Liu, Yanheng Zhou Department of Orthodontics, Peking University School and Hospital of Stomatology, National Engineering Laboratory for Digital and Material Technology of Stomatology Beijing Key Laboratory of Digital Stomatology, Beijing, China ARTICLE INFO ABSTRACT bjective: This study aims to investigate the responsiveness of transcription factor Tea domain family member 1 (TEAD1) to mechanical force and its impact on osteoclastogenesis as well as expression of Osteoprotegerin TEa domain family member 1 (TEADl) PG), an inhibitor for osteoclastogenesis playing crucial roles in mechanical stress-induced bone remodeling Human periodontal ligament cell(PDLC) d orthodontic tooth movement (otm). Osteoclast differentiation Methods: We first analyzed the correlation between several transcription factors and OPG expression in human eriodontal ligament cells(PDLCs). Then dynamic expression changes of TEADI with force application nalyzed due to its high correlation with OPG Loss-of-function experiments were performed to demonstrate the role of TEADI in regulation of RANKL/OPG, as well as osteoclastogenesis by tartrate- resistant acid phosphatase (TRAP)staining. Combination of bioinformatics analyzes and chromatin immunoprecipitation assay was utilized investigate occupancy of TEADI on the enhancer elements of OPG and the dynamic change in response to force stimuli. Involvement of Hippo signaling in regulation of OPG was further demonstrated by pharmacologic hibitors of several Results: Expression of TEADI highly correlates with that of OPG and decreases in response to mechanical force in human PDLCs. Knockdown of TEADI downregulates expression of OPG and promotes osteoclast differ- entiation. Mechanical force induced decreased binding of TEADl on an enhancer element 22 kilobases upstream of OPG promoter OPG was also affected by pharmaceutical disruption of Hippo signaling pathway. Conchusions: TEADI is a novel mechano-responsive gene and plays an important role in force-induced osteo- clastogenesis, which is dependent, as least partially, on transcriptional regulation of OPG. 1. Introduction factor-kB(RANKL)/ osteoprotegerin (OPG) axis plays a pivotal role and is considered to be a rate-limiting determinant for OTM (Ya Periodontal ligament is the soft connective tissue lying betv 2009). OPG inhibits osteoclastogenesis as a decoy receptor Lacey, 2003; Simonet et al (Beertsen, McCulloch, Sodek, 1997). Periodontal ligament cells are 1997). Expression of OPG was reported to be downregulated both in mainly composed of heterogeneous fibroblasts that include osteogenic vivo and in vitro after force application. (Li et al., 2011, 2013; Li, Zhang, progenitor cells. Besides, there are cementum cells, macrophages and Wang, Li, Zhang, 2015; Nishijima et al, 2006; Toygar, Kircelli, Bulut, lymphocytes in the periodontal ligament (Jiang et al., 2016). During Sezgin, Tasdelen, 2008)Moreover, local OPG gene transfer to peri mechanical stimuli-induced orthodontic tooth movement (OTM), odontal tissue could inhibit OTM (Kanzaki et al, 2004), underlying the impressive force applied on the periodontal ligament could induce importance of oPG in osteoclastogenesis during OTM. However, up to osteoclastogenesis through secretion of a series of pro-inflammatory now, its upstream regulators responding to mechanical cues remain cytokines including interleukin 1(IL-1), interleukin 6 (IL-6), and cy. elusive clooxygenase 2(COX-2), etc. Importantly, the receptor activator of Mechanical forces are sensed primarily at integrin-extracellular clear factor-kB (RANK)/ ligand for the receptor activator of nuclear matrix and cell-cell adhesion sites at cell surface. Then the information Corresponding authors at: Department of Orthodontics, Peking University, School Hospital of Stomatology, 22 Zhongguancun South Avenue, Beijing 100081 E-mailaddresses:qianli@bjmueducn(Q.Li),yanhengzhou@vip.163.com(Y.Zhou) https://doi.org/10.1016/j.archoralbio.2019.01.020 Received 17 September 2018; Received in revised form 28 January 2019: Accepted 30 January 2019 003-9969/@ 2019 Elsevier Ltd. All rights reserved

Contents lists available at ScienceDirect Archives of Oral Biology journal homepage: www.elsevier.com/locate/archoralbio Force-induced decline of TEA domain family member 1 contributes to osteoclastogenesis via regulation of Osteoprotegerin Qian Li⁎ , Gaofeng Han, Dawei Liu, Yanheng Zhou⁎ Department of Orthodontics, Peking University School and Hospital of Stomatology, National Engineering Laboratory for Digital and Material Technology of Stomatology, Beijing Key Laboratory of Digital Stomatology, Beijing, China ARTICLE INFO Keywords: Osteoprotegerin (OPG) TEA domain family member 1 (TEAD1) Human periodontal ligament cell (PDLC) Osteoclast differentiation ABSTRACT Objective: This study aims to investigate the responsiveness of transcription factor TEA domain family member 1 (TEAD1) to mechanical force and its impact on osteoclastogenesis as well as expression of Osteoprotegerin (OPG), an inhibitor for osteoclastogenesis playing crucial roles in mechanical stress-induced bone remodeling and orthodontic tooth movement (OTM). Methods: We first analyzed the correlation between several transcription factors and OPG expression in human periodontal ligament cells (PDLCs). Then dynamic expression changes of TEAD1 with force application were analyzed due to its high correlation with OPG. Loss-of-function experiments were performed to demonstrate the role of TEAD1 in regulation of RANKL/OPG, as well as osteoclastogenesis by tartrate-resistant acid phosphatase (TRAP) staining. Combination of bioinformatics analyzes and chromatin immunoprecipitation assay was utilized to investigate occupancy of TEAD1 on the enhancer elements of OPG and the dynamic change in response to force stimuli. Involvement of Hippo signaling in regulation of OPG was further demonstrated by pharmacologic inhibitors of several components. Results: Expression of TEAD1 highly correlates with that of OPG and decreases in response to mechanical force in human PDLCs. Knockdown of TEAD1 downregulates expression of OPG and promotes osteoclast differentiation. Mechanical force induced decreased binding of TEAD1 on an enhancer element ˜22 kilobases upstream of OPG promoter. OPG was also affected by pharmaceutical disruption of Hippo signaling pathway. Conclusions: TEAD1 is a novel mechano-responsive gene and plays an important role in force-induced osteoclastogenesis, which is dependent, as least partially, on transcriptional regulation of OPG. 1. Introduction Periodontal ligament is the soft connective tissue lying between cementum and the alveolar bone. It plays crucial roles in providing vascular supply and nutrients, as well as maintaining bone homeostasis (Beertsen, McCulloch, & Sodek, 1997). Periodontal ligament cells are mainly composed of heterogeneous fibroblasts that include osteogenic progenitor cells. Besides, there are cementum cells, macrophages and lymphocytes in the periodontal ligament (Jiang et al., 2016). During mechanical stimuli-induced orthodontic tooth movement (OTM), compressive force applied on the periodontal ligament could induce osteoclastogenesis through secretion of a series of pro-inflammatory cytokines including interleukin 1 (IL-1), interleukin 6 (IL-6), and cyclooxygenase 2 (COX-2), etc. Importantly, the receptor activator of nuclear factor-κB (RANK)/ ligand for the receptor activator of nuclear factor-κB (RANKL)/ osteoprotegerin (OPG) axis plays a pivotal role and is considered to be a rate-limiting determinant for OTM (Yamaguchi, 2009). OPG inhibits osteoclastogenesis as a decoy receptor to prevent the interaction between RANK and its ligand RANKL in bone homeostasis and osteoporosis (Boyle, Simonet, & Lacey, 2003; Simonet et al., 1997). Expression of OPG was reported to be downregulated both in vivo and in vitro after force application. (Li et al., 2011, 2013; Li, Zhang, Wang, Li, & Zhang, 2015; Nishijima et al., 2006; Toygar, Kircelli, Bulut, Sezgin, & Tasdelen, 2008) Moreover, local OPG gene transfer to periodontal tissue could inhibit OTM (Kanzaki et al., 2004), underlying the importance of OPG in osteoclastogenesis during OTM. However, up to now, its upstream regulators responding to mechanical cues remain elusive. Mechanical forces are sensed primarily at integrin–extracellular matrix and cell–cell adhesion sites at cell surface. Then the information https://doi.org/10.1016/j.archoralbio.2019.01.020 Received 17 September 2018; Received in revised form 28 January 2019; Accepted 30 January 2019 ⁎ Corresponding authors at: Department of Orthodontics, Peking University, School & Hospital of Stomatology, 22 Zhongguancun South Avenue, Beijing 100081, China. E-mail addresses: qianli@bjmu.edu.cn (Q. Li), yanhengzhou@vip.163.com (Y. Zhou). Archives of Oral Biology 100 (2019) 23–32 0003-9969/ © 2019 Elsevier Ltd. All rights reserved. T

Archives of Oral Biology 100(2019)23-32 cytoplasm, and such inactivation will eventually lead to the cessation of concentration 2 HM), and the YAP/TaZ activity inhibitor verteporfin transcription of their target gene(Meng et al., 2016). When these two (Med Chem Express) transcriptional coactivators are shuttled into nucleus, they could in- teract with the TEa domain (TEAD) family transcription factors to 2. 2. Flow cytometry analyses regulate a broad spectrum of downstream genes with diverse roles in self-renew of stem cell, cell proliferation and fate determination Cells were washed with PBS, detached with 0. 25% trypsin, (Zanconato, Cordenons, Piccolo, 2016) with 75% ethanol overnight. After treatment with 1 mg/ml In mammals, four highly conserved TEAD transcription factors have (Sigma)at 37'C for 30 min, cells were resuspended in 0.5 ml of been identified as TEAD1, TEAD2, TEAD3 and TEAD4 (Xiao, Davidson, stained with propidium iodide in the dark for 30 min Fluorescence was Matthes, Garnier, Chambon, 1991). Though TEADs can be detected in measured with a flow cytometry system(BD Biosciences). The cell cy- almost any eukaryotes, Kaneko DePamphilis, 1998) their expression cles were analyzed using the Modfit software. patterns are distinct and each of them has a unique function in con- trolling both physiologic processes and oncogenic malignancies 2.3. Co-culture of PDLcs and RAw 264.7 or human peripheral blood Jacquemin et al, 1998; Kaneko, Cullinan, Latham, DePamphilis, mononuclear cells(PBMCs)and TRAP staining 1997; Zhou et al, 2016). Moreover, though TEADs' function as tran- scription factors require interaction with coactivators such as YAP/TAZ PDLCs were seeded into 6-well plates and transfected with siRNAs and p160, aberrant transcriptional levels of TEADs are found in various against TEADI or the non-sense control siRNA. Then the cells were types of cancer which correlate with poor clinical outcome(Pobbati subjected to compressive force of 1.5 g/cm for 24 h, and RAW264.7 Hong, 2013), indicating the important role of TEADs in cell functional cells were added to the well. After 7 days, the cells were fixed and naintenance. In addition, YAP/TAZ has been reported to be involved in stained for TRAP staining using acid phosphatase kit (387 A, Sigma). regulation of osteoblast and osteoclast differentiation, though the TRAP-positive multinucleated osteoclasts were counted in 5 visual conclusions are still controversial (Hong et al., 2005; Kegelman et al., fields in each well (n= 3). We calculated the average value of 3 ex- 2018; Zaidi et al., 2004), raising the possibility that Hippo signaling periments. Human PBMCs were primarily derived from periphery might also be involved in mechanical stress-induced bone remodeling blood. Then the PBMCs were co-cultured with PDLCs and subjected to process. Therefore, we believe it necessary to investigate whether TRAP staining 21 days later TEADs family and YAP/TAZ could transcriptionally respond to me. chanical stress and mediate downstream target genes regulation re- 2. 4. Fractionation, western blotting analyses and antibodies garding osteoclast differentiation. In this study, we identified TEADI as a novel mechano re Cultured cells were harvested after washing with ice-cold phos- gene in human PDLCs. We showed that TEAD1 decreased upon force phate-buffered saline and then lysed in extraction buffer(50 mM Tris- stimuli, correlating with the expression of OPG. Loss-of-function ex- HCl, PH 8.0. 150 mM NaCl, 1 mM EDTA, 0.5% Nonidet p-40, 0.01% periments indicated TEADl-mediated regulation of RANKL/OPG and protease inhibitor mixture) Cells were fractionated using Nuclease and osteoclastogenesis of co-cultured RAW264.7 cells. We further dissected Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, MA, USA), the molecular basis for TEADI's function with physical cues induced according to the manufacturer's protocol. dynamic binding on a distal enhancer element of OPG in human PDLCs. estern blotting analyses were performed as previously described (Zhang et aL, 2016). Antibodies used are as follows: anti-TEAD 2. Materials and methods (13283-1-AP, Proteintech); anti-OPG (ab11994, Abcam); anti-glycer aldehyde- 3-phosphate dehydrogenase (GAPDH)(sc-47724, Santa 2.1. Cell lines, cell culture and treatments Cruz): anti-RANKL (ab45039, Abcam); anti-Phospho-YAP(Ser127) Human PDLCs were isolated from PDL of normal orthodontic ex- (Ser397)(#13619, CST), anti-YAP/TAZ (#8418, CST); anti-B-actin tracted bicuspid, according to previously reported protocols with slight (#3700, CST); anti-lamin A/C (#4777, CST). modification (Iwata et aL, 2010; Zheng et al, 2009). Tissues were ob- tained under approved guidelines set by Peking University Ethical 2.5. siRNA transfection, plasmid transfection and quantitative reverse. Committee with informed donor consent. Briefly, the PDL tissues of 7 transcription polymerase chain reaction(qRT-PCR) donors were separated from the mid-third of the root surface and minced into small tissue cubes. Subsequently, the tissue cubes were Two double-stranded siRNAs against TEADI and the scrambled digested with a solution of 3 mg/mL collagenase(type D) with 4 mg/mL control siRNA (siNC) were chemically synthesized(GenePharma). The dispase(both from Sigma-Aldrich) in a-minimum essential medium(a- sequences of siRNA are as follows: siTEADl-1: CGATUUGUAUACCGA clone) for 15 AUAA: siTEAD1-2: GAAAGGUGGCUUAAAGGAA. Transfection of explants were then plated into culture dishes containing a-MEM sup- siRNa was performed using the Lipofectamin RNAiMAX (Invitrogen) Itamine(Hyclone), 100 units/mL penicillin streptomycin(Hycloy F plemented with 10% fetal bovine serum(FBS; Hyclone), 0.292 mg/m following the manufacturer's instruction The TEADl overexpression plasmid pRK5-Myc-TEADl and the and 100 mM/L ascorbic acid(Sigma-Aldrich) and incubated at 37C in empty control vector pRKS were purchased from Addgene Transfection a humidified atmosphere containing 5%CO2 Cells were used in this of plasmid was performed using Lipofectamine LTX (Invitrogen) fol- study with 4 to 6 passages In Figs. 2-5, PDLCs isolated from 3 of the 7 lowing the manufacturers instruction. individuals were pooled together and used. Total RNAs were extracted from PDLCs using Trizol reagent a, Static compressive force was applied as previously described. (Invitrogen). Synthesis of first strand cDNA and subsequent quantitative Mitsui et al., 2005)A layer of glass cover and additional metal weights PCR were performed as previously described. All qRT-PCR processes were placed on top of an 80% confluent cell layer in 6-well plates. Cells were performed three times using GAPDH as the internal control. The were subjected to different continuous compressive forces ranging from primers used in this study are as listed below: GAPDH forward (F): 0 to 1.5g/cm2 for 24h(h)or at 1.5g/cm'for different durations ran. caatgaccccttcattgacc, GAPDH reverse(R): atgacaagcttcccgttctc: RANKL ging from 0 to 24h. F: ATCACAGCACATCAGAGCAGAGA, RANKL R: AGGACAGACTCACT To evaluate the influence of Hippo signaling on OPG expression, the TTATGGGAAC; oPG F: gaggcattcttcaggtttge, OPG R nhibitors were used in this study: the JNK inhibitor gctgtgttgccgttttatcc; TEADI F: cttgccagaaggaaatctcg, TEAD1 R: SP600125(Selleck), the MST1/2 inhibitor XMU-MP-1(Selleck, final ccccagcttgttatgaatgg: TEAD2 F: ttttggtctggaggatctgg, TEAD2 R:

cytoplasm, and such inactivation will eventually lead to the cessation of transcription of their target gene (Meng et al., 2016). When these two transcriptional coactivators are shuttled into nucleus, they could interact with the TEA domain (TEAD) family transcription factors to regulate a broad spectrum of downstream genes with diverse roles in self-renew of stem cell, cell proliferation and fate determination (Zanconato, Cordenonsi, & Piccolo, 2016). In mammals, four highly conserved TEAD transcription factors have been identified as TEAD1, TEAD2, TEAD3 and TEAD4 (Xiao, Davidson, Matthes, Garnier, & Chambon, 1991). Though TEADs can be detected in almost any eukaryotes,(Kaneko & DePamphilis, 1998) their expression patterns are distinct and each of them has a unique function in controlling both physiologic processes and oncogenic malignancies (Jacquemin et al., 1998; Kaneko, Cullinan, Latham, & DePamphilis, 1997; Zhou et al., 2016). Moreover, though TEADs’ function as transcription factors require interaction with coactivatiors such as YAP/TAZ and p160, aberrant transcriptional levels of TEADs are found in various types of cancer which correlate with poor clinical outcome (Pobbati & Hong, 2013), indicating the important role of TEADs in cell functional maintenance. In addition, YAP/TAZ has been reported to be involved in regulation of osteoblast and osteoclast differentiation, though the conclusions are still controversial (Hong et al., 2005; Kegelman et al., 2018; Zaidi et al., 2004), raising the possibility that Hippo signaling might also be involved in mechanical stress-induced bone remodeling process. Therefore, we believe it necessary to investigate whether TEADs family and YAP/TAZ could transcriptionally respond to mechanical stress and mediate downstream target genes regulation regarding osteoclast differentiation. In this study, we identified TEAD1 as a novel mechano-responsive gene in human PDLCs. We showed that TEAD1 decreased upon force stimuli, correlating with the expression of OPG. Loss-of-function experiments indicated TEAD1-mediated regulation of RANKL/OPG and osteoclastogenesis of co-cultured RAW264.7 cells. We further dissected the molecular basis for TEAD1′s function with physical cues induced dynamic binding on a distal enhancer element of OPG in human PDLCs. 2. Materials and methods 2.1. Cell lines, cell culture and treatments Human PDLCs were isolated from PDL of normal orthodontic extracted bicuspid, according to previously reported protocols with slight modification (Iwata et al., 2010; Zheng et al., 2009). Tissues were obtained under approved guidelines set by Peking University Ethical Committee with informed donor consent. Briefly, the PDL tissues of 7 donors were separated from the mid-third of the root surface and minced into small tissue cubes. Subsequently, the tissue cubes were digested with a solution of 3 mg/mL collagenase (type I) with 4 mg/mL dispase (both from Sigma-Aldrich) in α-minimum essential medium (α- MEM, Hyclone) for 15 min at 37 °C with vigorous shaking. The tissue explants were then plated into culture dishes containing α-MEM supplemented with 10% fetal bovine serum (FBS; Hyclone), 0.292 mg/mL glutamine (Hyclone), 100 units/mL penicillin streptomycin (Hyclone), and 100 mM/L ascorbic acid (Sigma-Aldrich) and incubated at 37 °C in a humidified atmosphere containing 5% CO2. Cells were used in this study with 4 to 6 passages. In Figs. 2–5, PDLCs isolated from 3 of the 7 individuals were pooled together and used. Static compressive force was applied as previously described. (Mitsui et al., 2005) A layer of glass cover and additional metal weights were placed on top of an 80% confluent cell layer in 6-well plates. Cells were subjected to different continuous compressive forces ranging from 0 to 1.5 g/cm2 for 24 h (h) or at 1.5 g/cm2 for different durations ranging from 0 to 24 h. To evaluate the influence of Hippo signaling on OPG expression, the following inhibitors were used in this study: the JNK inhibitor SP600125 (Selleck), the MST1/2 inhibitor XMU-MP-1 (Selleck, final concentration 2 μM), and the YAP/TAZ activity inhibitor verteporfin (MedChemExpress). 2.2. Flow cytometry analyses Cells were washed with PBS, detached with 0.25% trypsin, and fixed with 75% ethanol overnight. After treatment with 1 mg/ml RNase A (Sigma) at 37 °C for 30 min, cells were resuspended in 0.5 ml of PBS and stained with propidium iodide in the dark for 30 min. Fluorescence was measured with a flow cytometry system (BD Biosciences). The cell cycles were analyzed using the Modfit software. 2.3. Co-culture of PDLCs and RAW 264.7 or human peripheral blood mononuclear cells (PBMCs) and TRAP staining PDLCs were seeded into 6-well plates and transfected with siRNAs against TEAD1 or the non-sense control siRNA. Then the cells were subjected to compressive force of 1.5 g/cm2 for 24 h, and RAW264.7 cells were added to the well. After 7 days, the cells were fixed and stained for TRAP staining using acid phosphatase kit (387 A, Sigma). TRAP-positive multinucleated osteoclasts were counted in 5 visual fields in each well (n = 3). We calculated the average value of 3 experiments. Human PBMCs were primarily derived from periphery blood. Then the PBMCs were co-cultured with PDLCs and subjected to TRAP staining 21 days later. 2.4. Fractionation, western blotting analyses and antibodies Cultured cells were harvested after washing with ice-cold phosphate-buffered saline and then lysed in extraction buffer (50 mM TrisHCl, pH 8.0. 150 mM NaCl, 1 mM EDTA, 0.5% Nonidet p-40, 0.01% protease inhibitor mixture). Cells were fractionated using Nuclease and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, MA, USA), according to the manufacturer’s protocol. Western blotting analyses were performed as previously described (Zhang et al., 2016). Antibodies used are as follows: anti-TEAD1 (13283-1-AP, Proteintech); anti-OPG (ab11994, Abcam); anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (sc-47724, Santa Cruz); anti-RANKL (ab45039, Abcam); anti-Phospho-YAP (Ser127) (#13008, Cell Signaling Technology, (CST)); anti-Phospho-YAP (Ser397) (#13619, CST), anti-YAP/TAZ (#8418, CST); anti-β-actin (#3700, CST) ; anti-lamin A/C (#4777, CST). 2.5. siRNA transfection, plasmid transfection and quantitative reversetranscription polymerase chain reaction (qRT-PCR) Two double-stranded siRNAs against TEAD1 and the scrambled control siRNA (siNC) were chemically synthesized (GenePharma). The sequences of siRNA are as follows: siTEAD1-1: CGATUUGUAUACCGA AUAA; siTEAD1-2: GAAAGGUGGCUUAAAGGAA. Transfection of siRNA was performed using the Lipofectamin RNAiMAX (Invitrogen) following the manufacturer’s instruction. The TEAD1 overexpression plasmid pRK5-Myc-TEAD1 and the empty control vector pRK5 were purchased from Addgene. Transfection of plasmid was performed using Lipofectamine LTX (Invitrogen) following the manufacturer’s instruction. Total RNAs were extracted from PDLCs using Trizol reagent (Invitrogen). Synthesis of first strand cDNA and subsequent quantitative PCR were performed as previously described. All qRT-PCR processes were performed three times using GAPDH as the internal control. The primers used in this study are as listed below: GAPDH forward (F): caatgaccccttcattgacc, GAPDH reverse (R): atgacaagcttcccgttctc; RANKL F: ATCACAGCACATCAGAGCAGAGA, RANKL R: AGGACAGACTCACT TTATGGGAAC; OPG F: gaggcattcttcaggtttgc, OPG R: gctgtgttgccgttttatcc; TEAD1 F: cttgccagaaggaaatctcg, TEAD1 R: ccccagcttgttatgaatgg; TEAD2 F: ttttggtctggaggatctgg, TEAD2 R: Q. Li, et al. Archives of Oral Biology 100 (2019) 23–32 25

Archives of Oral Biology 100(2019) B 00511.5(g/cm2) 061224(h) 061224(h) TEAD1 TEAD1 GAPDH GAPDH RANKL GAPDH 51 0.8 0.8 0.8 0.6 0.6 0 0 061224(h) 15(g/cm2) 061224(h) 12 1.2 8 0.8 000 1 0.6 0.4 0.2 061224(h) 061224(h) .zgo Fig. 2. Compressive force decreases expressions of TEADl in human PDLCs. (A)Forces with different intensity induced downregulation of TEADl. PDLCs were treated with increasing force intensity for 24 h, followed by total proteins and mRNA extraction. Expression changes of TEADI were determined by western blot(top and middle) and qRT-PCR (bottom), respectively. (B) Force induced downregulation of TEADI in a time-dependent manner. PDLCs were treated with varying durations at 1.5 g/cm2 force, followed by total proteins and mRNA extraction. Ex changes of TEADI were determined by western blot(top and middle)and qRT-PCR(bottom), respectively. (C) Protein levels of RANKL and OPG changed with force application. Western blotting analysis of RANKL and OPG in PDLCs exposed to compressive force of 1.5 g/cm- for prolonged time durations(F). GAPDH serves as a loading control. Data represent mean t SD from three independent experiments. P <0.05(n=3 atgggggagtcagtgacaag i TEAD3 F: agatgtacggccgaaatgag, TEAD3 R: 2.6. Bioinformatics analy ttttctcgtccgagtcttcc; TEAD4 F: tcatccacaagctcaagcac TEAD4 R: tcatcca- caagctcaagcac; SRF F: Gccactggctttgaagagac, SRF R: tgctaggtgctgtttg The genome-wide DNase I sensitivity data for periodontal ligamer gatg: NF-KB subunit p65 F: Tgggaatccagtgtgtgaag, p65 R: cells was retrieved from the ENcODE project(Consortium, aaggggttgttgttggtctg. IL-6 F: aggcactggcagaaaacaac, IL-6 R: ttttcac. used homer(Heinz et al., 2010) software to scan the whole genome for caggcaagtctcc; IL-l F: tgcctgagatacccaaaacc, IL-l R: gtttggatgggcaact- TEAD motifs. gatg; colony stimulating factor 1(M-CSF)F: ttgtcaaggacagcaccatc, M- CSF R: ttctgggacccaattagtgc; m(mouse)c-fos F: agaaacggagaatccgaagg, 2.7. Chromatin immunoprecipitation assay mc-fos R: tgcaacgcagacttctcatc; m nuclear factor of activated T cells 1 fatal)F: tgggagatggaagcaaagac, mNfatcl R: ttgcggaaaggtggtatctc; precipitation assay was pe mgapdh F: aacgaccccttcattgacctc, gapdh R: actgtgccgttgaatttgcc SimplechIP Chromatin Ip (Immuno (#9002, CST) according to manufacturers instruction. The antibod used was TEAD1 (#12292, CST). The precipitated DNA was quantified by qPCR using primers, which were designed according to the 5 regions

atgggggagtcagtgacaag ; TEAD3 F: agatgtacggccgaaatgag, TEAD3 R: ttttctcgtccgagtcttcc; TEAD4 F: tcatccacaagctcaagcac TEAD4 R: tcatccacaagctcaagcac; SRF F: Gccactggctttgaagagac, SRF R: tgctaggtgctgtttggatg; NF-ƙB subunit p65 F: Tgggaatccagtgtgtgaag, p65 R: aaggggttgttgttggtctg. IL-6 F: aggcactggcagaaaacaac, IL-6 R: ttttcaccaggcaagtctcc; IL-1 F: tgcctgagatacccaaaacc, IL-1 R: gtttggatgggcaactgatg; colony stimulating factor 1(M-CSF) F: ttgtcaaggacagcaccatc, MCSF R: ttctgggacccaattagtgc; m (mouse) c-fos F: agaaacggagaatccgaagg, mc-fos R: tgcaacgcagacttctcatc; m nuclear factor of activated T cells 1 (Nfatc1) F: tgggagatggaagcaaagac, mNfatc1 R: ttgcggaaaggtggtatctc; mgapdh F: aacgaccccttcattgacctc, mgapdh R: actgtgccgttgaatttgcc. 2.6. Bioinformatics analysis The genome-wide DNase I sensitivity data for periodontal ligament cells was retrieved from the ENCODE project (Consortium, 2012). We used homer (Heinz et al., 2010) software to scan the whole genome for TEAD motifs. 2.7. Chromatin immunoprecipitation assay Chromatin immunoprecipitation assay was performed using the SimpleChIP Enzymatic Chromatin IP (Immunoprecipitation) Kit (#9002, CST) according to manufacturer’s instruction. The antibody used was TEAD1 (#12292, CST). The precipitated DNA was quantified by qPCR using primers, which were designed according to the 5 regions Fig. 2. Compressive force decreases expressions of TEAD1 in human PDLCs. (A) Forces with different intensity induced downregulation of TEAD1. PDLCs were treated with increasing force intensity for 24 h, followed by total proteins and mRNA extraction. Expression changes of TEAD1 were determined by western blot (top and middle) and qRT-PCR (bottom), respectively. (B) Force induced downregulation of TEAD1 in a time-dependent manner. PDLCs were treated with varying durations at 1.5 g/cm2 force, followed by total proteins and mRNA extraction. Expression changes of TEAD1 were determined by western blot (top and middle) and qRT-PCR (bottom), respectively. (C) Protein levels of RANKL and OPG changed with force application. Western blotting analysis of RANKL and OPG in PDLCs exposed to compressive force of 1.5 g/cm2 for prolonged time durations (F). GAPDH serves as a loading control. Data represent mean ± SD from three independent experiments. *P < 0.05. (n = 3). Q. Li, et al. Archives of Oral Biology 100 (2019) 23–32 26