Properties of genetic code 1.Commaless The genetic codons should be read continuously without spacing or overlapping. spacing UUCUCGGACCUGGAGAUUCACAGU UUCUCGGACCUGGAGAUUCACAGU X Accuracy of start site 来 overlapping
1. Commaless ⚫ Properties of genetic code The genetic codons should be read continuously without spacing or overlapping. ※ Accuracy of start site U U C U C G G A C C U G G A G A U U C A C A G U U U C U C G G A C C U G G A G A U U C A C A G U spacing overlapping × ×
Gene damage may causebase insertion or deletion on mRNA template,which leads to frame shift mutation. mRNA 5'---G U A G CC U A C GG A U---3 (+) Insertion ---G UAGC CU C A C GG A U--- (-) Deletion --G UAC C UA C GG A U---
Gene damage may causebase insertion or deletion on mRNA template, which leads to frame shift mutation. Insertion Deletion
2.Sideness Reading frame:5'-3' Translation:5’-3
2. Sideness Reading frame：5’—3’ Translation ：5’—3’
3.Degeneracy codel amino acid 1 (except Trp,Met) Code2/3/4/6 Providing multiple options for maintaining stabilization of species
3. Degeneracy amino acid (except Trp, Met) code1 Code2/3/4/6 Providing multiple options for maintaining stabilization of species
Number of genetic Number of genetic AA AA codon codon Ala 4 Leu 6 Arg 6 Lys 2 Asn 2 Met 1 Asp 2 Phe 2 Cys 2 Pro 4 Gln 2 Ser 6 Glu 2 Thr 4 Gly 4 Trp 1 His 2 Tyr 2 Ile 3 Val 4
AA Number of genetic codon AA Number of genetic codon