Restriction Fragment LengthPolymorphismsDNA sequences vary, even among members ofthe same speciesDifferences in the cutting pattern of specificrestriction endonucleases give rise to fragmentsof differing lengths (RFLPs)6
6 Restriction Fragment Length Polymorphisms • DNA sequences vary, even among members of the same species • Differences in the cutting pattern of specific restriction endonucleases give rise to fragments of differing lengths (RFLPs)
MICRestriction Fragment LengthawPolymorphisms(RFLPs)GAATTCGAATTCGAATTCCTTAAGCTTAAGCTTAAG品PlayPauseAudioTextRestriction enzymes recognize very specific sequences ofnucleotides in DNACopyright@TheMcGraw-Hill Companies,Inc
Enzymes forDicing,Splicing,andReversingNucleicAcidsLigase-rejoins phosphate-sugar bonds(stickyends)cutbyendonucleasesUsed for final splicing of genes into plasmidsandchromosomes8
8 Enzymes for Dicing, Splicing, and Reversing Nucleic Acids • Ligase – rejoins phosphate-sugar bonds (sticky ends) cut by endonucleases • Used for final splicing of genes into plasmids and chromosomes
Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or displayFEXRestrictionendonucleasemakesstaggeredcutatpalindrome.ASite of cut(1)ICITAGGATICKTAGC+￥GAT★Stickyends(2)DNAOrganism1DNAOrganism2Action ofrestrictionendonucleases.(1)Arestrictionendonucleaserecognizesandcleaves DNAatthe siteofaspecificpalindromicsequence.Cleavageusuallyproducesstaggeredtailscalledstickyendsthataccept9complementarytailsforgenesplicing.ThispalindromeiscutbyAcil(2)Thestickyendscanbe usedto joinDNAfromdifferentorganismsbycuttingit withthesamerestrictionenzyme,ensuringthatbothfragmentshavetwocomplementaryends.ThispalindromeiscutbyTagl
9 DNA Organism 1 (2) DNA Organism 2 Action of restriction endonucleases. (1) A restriction endonuclease recognizes and cleaves DNA at the site of a specific palindromic sequence. Cleavage usually produces staggered tails called sticky ends that accept complementary tails for gene splicing. This palindrome is cut by Aci I. (2) The sticky ends can be used to join DNA from different organisms by cutting it with the same restriction enzyme, ensuring that both fragments have two complementary ends. This palindrome is cut by Taq I. Restriction endonuclease makes staggered cut at palindrome. Site of cut Sticky ends C T A G G A T C C T A G G A T C (1) Copyright © The McGraw -Hill Companies, Inc. Permission required for reproduction or display
EnzymesforDicing,Splicing,andReversingNucleicAcidsReversetranscriptase-makes a DNA copy of RNA-CDNAcDNAcan bemadefrommRNA,tRNA, orrRNAProvides a means of synthesizing eukaryotic genes frommRNA transcripts - synthesized gene is free of introns10
10 Enzymes for Dicing, Splicing, and Reversing Nucleic Acids • Reverse transcriptase – makes a DNA copy of RNA – cDNA • cDNA can be made from mRNA, tRNA, or rRNA • Provides a means of synthesizing eukaryotic genes from mRNA transcripts – synthesized gene is free of introns