3.DNAReplication in ProkaryotesOri in E.coli(1)(2)Initiation of DNAreplication in E.coli(3)DNApolymerases寳Pol lI:implicated inDNArepair.Pol l: involved in replication of damaged DNAPol Ill:elongatesinDNAreplicationPolIV:aY-familyDNApolymerasePol V: a Y-family DNA polymerase; participates in bypassing DNAdamage.(4)SemidiscontinuousreplicationThismethod of replication for the lagging strand is a little less foolproof, thelaggingstrandmustonlyreplicateintinylittlesegments.Thesegments,referredtoasOkazakifraaments,aresynthesizedinthe5'to3directionawayfromthereplicationforkThesefragments arethenstitchedtogetherbyDNA ligase, creating acontinuous strandThistypeof replication is calledsemidiscontinuousreplicationLeading and Lagging StrandseachOkazakifragmenthasitsownprimermade discontinuouslyDNAreplicationis semidiscontinuousPrimase00DNAhelicaseLagging strandRNAPrimer-MovementofhelicaseLeadingstrandSingle-strand-bindingprotein(SSB)Termination of Replication(5)19
19 3. DNA Replication in Prokaryotes (1) Ori in E.coli (2) Initiation of DNA replication in E.coli (3) DNA polymerases Pol I: implicated in DNA repair Pol II: involved in replication of damaged DNA Pol III: elongates in DNA replication Pol IV: a Y-family DNA polymerase Pol V: a Y-family DNA polymerase; participates in bypassing DNA damage. (4) Semidiscontinuous replication This method of replication for the lagging strand is a little less foolproof, the lagging strand must only replicate in tiny little segments. The segments, referred to as Okazaki fragments, are synthesized in the 5’ to 3’ direction away from the replication fork. These fragments are then stitched together by DNA ligase, creating a continuous strand. This type of replication is called semidiscontinuous replication. (5) Termination of Replication
(6)RollingCircleReplication.OHNucleasecutsNucleotideaddedto3'-OH enddisplacingotherend5'-PDiroctionofrolling5'-pOtherstrandcopied discontinuously4.DNAReplicationinEukaryotes(1)Multiplereplicons(2)DNApolymerasePol a: Acts as a primase (synthesizing a RNA primer), and then as a DNAPol elongating that primer with DNA nucleotides. After around 20nucleotides elongation is taken over by Pol (on the lagging strand)and (on the leading strand).Pol β:Implicated in repairing DNA, in base excision repair and gap-fllingsynthesis.Poly:Replicatesmitochondrial DNAPol : Highly processive and has proofreading 3'->5'exonuclease activityThought to be the main polymerase involved in lagging strandsynthesis, though there is still debate about its role.Pol :Also highly processive and has proofreading 3'->5'exonucleaseactivity. Highly related to Pol o, and thought to be the mainpolymerase involved in leading strand synthesis......still debateabout its role.20
20 (6) Rolling Circle Replication 4. DNA Replication in Eukaryotes (1) Multiple replicons (2) DNA polymerase Pol α: Acts as a primase (synthesizing a RNA primer), and then as a DNA Pol elongating that primer with DNA nucleotides. After around 20 nucleotides elongation is taken over by Pol δ (on the lagging strand) and ε (on the leading strand). Pol β: Implicated in repairing DNA, in base excision repair and gap-filling synthesis. Pol γ: Replicates mitochondrial DNA. Pol δ: Highly processive and has proofreading 3'->5' exonuclease activity. Thought to be the main polymerase involved in lagging strand synthesis, though there is still debate about its role. Pol ε: Also highly processive and has proofreading 3'->5' exonuclease activity. Highly related to Pol δ, and thought to be the main polymerase involved in leading strand synthesis.still debate about its role
(3)ReplicationofTelomereAtelomereisa regionof repetitiveDNAattheendof chromosomes,whichprotectstheendofthechromosomefromdestruction.Telomerase-Telomerase isa ribonucleoproteinthat is an enzymemadeof protein and RNA subunits.Its role istoelongate chromosomes byaddingtelomericsequencestotheendofexistingchromosomes.Asaresult,everytimethechromosomeiscopied,only100-200nucleotidesarelost,whichcausesnodamagetotheorganism'sDNATelomerase is a reverse transcriptase that carries its own RNAmolecule, which is used as a template when it elongates telomeres,whichareshortenedaftereachreplicationcycle.remainderoftelomeraseproteintelomerase RNA"fingers"regionoftelomeraseRNAusedastemplate"palm"-active siteoftelomeraseproteinCnewly"thumb"restofsynthesizedtelomerechromosomeDNAReplicationofTelomere21
21 (3) Replication of Telomere A telomere is a region of repetitive DNA at the end of chromosomes, which protects the end of the chromosome from destruction. Telomerase - Telomerase is a ribonucleoprotein that is an enzyme made of protein and RNA subunits. Its role is to elongate chromosomes by adding telomeric sequences to the end of existing chromosomes. As a result, every time the chromosome is copied, only 100–200 nucleotides are lost, which causes no damage to the organism's DNA. Telomerase is a reverse transcriptase that carries its own RNA molecule, which is used as a template when it elongates telomeres, which are shortened after each replication cycle. Replication of Telomere
parental strandTTGGGGTTGGGGTTGGGGTTGAACCCCincomplete,newlysynthesizedlaggingstrandTELOMERASEBINDSdirectionofTTGGGGTTGGGGTTGGGGTTGtelomereACCCCAAC二AACCCCsynthesis3TELOMERASEEXTENDS3'ENDtelomerasewithbound RNAtemplate(RNA-templatedDNAsynthesis)TTGGGGTTGGGGTTGGGGTTGGGGTTGGGGTTGACCCCAACAACCCC52COMPLETIONOFLAGGINGSTRANDBYDNAPOLYMERASE(DNA-templatedDNA synthesis)TTGGGGTTGGGGTTGGGGTTGGGGTTGGGGTTGAACCCCCCCCAACCCCAACCCC-DNApolymerase3'5'工工5'3'Telomerase extends the 3'-overhangNewDNAII5'When enough DNA has been synthesized,a new Okazaki fragment can be primedOkazaki fragment5PrimerHHH5'3'22
22