How genes affect each other Cis elements: sequences on DNA that affects the level of transcription. Trans factors: DNA-binding proteins that change the level of transcription by basal transcription machinery TFIID TF‖E TFIIF TFIIA Start site TAFs DNA ● TBP RNAP‖ TFIIB TFIIH CTD
• Cis elements: sequences on DNA that affects the level of transcription. • Trans factors: DNA-binding proteins that change the level of transcription by basal transcription machinery. How genes affect each other
Cis element may be a promoter Cis elements: sequences on dna that affects the level of transcription e.g. this may be a strong signal, and the green protein may bind to it strongly. ACTCATCTAGTATAATACTCATCCCGCGA This is a weakened version of the signal, so the protein doesnt bind, or maybe binds less strongly ACTTCATCTAGTGTACATACITCATCCCGCGTA
Cis elements: sequences on DNA that affects the level of transcription. ACTTCATCTAGTATAATACTCATCCCGCGTA… ACTTCATCTAGTGTACATACTCATCCCGCGTA… Cis element may be a promoter e.g. this may be a strong signal, and the green protein may bind to it strongly. This is a weakened version of the signal, so the protein doesn’t bind, or maybe binds less strongly
Examples of Trans Factors Some genes inhibit other genes; suppose protein Y sticks to DNA at the precise pattern CAGGCg CAGGCC Promoter gene The transcription factors just cant get to where they need to be, so if protein y is being produced, then genes with this pattern nearby just wont be expressed
Examples of Trans Factors Some genes inhibit other genes; suppose protein Y sticks to DNA at the precise pattern CAGGCG Promoter gene The transcription factors just can’t get to where they need to be, so if protein Y is being produced, then genes with this pattern nearby just won’t be expressed. CAGGCCG
Operons In prokaryotes and nematodes w A segment of dnA containing adjacent genes including structural genes, an operator gene and a regulatory gene(promoter/suppressor) structural genes in an operon, by interacting witho CD oPERATOR dNa that regulates the activity of the specifIc repressor or activator PROMOtER="binding site for transcription enzyme at That is the entiRe region is switched on or off
Prokaryotic Gene Expression Promoter Cistron Cistron2 CistronN Terminator Transcription I RNA Polymerase mRNA 5C 3 Translation Ribosome trNas Protein factors Polypeptides
Prokaryotic Gene Expression Promoter Cistron1 Cistron2 CistronN Terminator Transcription RNA Polymerase mRNA 5’ 3’ Translation Ribosome, tRNAs, Protein Factors 1 2 N Polypeptides N C N C N C 1 2 3