2021/1/21 Topic 1: mRNA -Only a portion of each mRNA can be translated a The protein-coding region of the mRna consists of an ordered series of 3-nt-long units called codons that specify the order of amino acids
2021/1/21 12 Topic 1: mRNA ◼ Only a portion of each mRNA can be translated. ◼ The protein-coding region of the mRNA consists of an ordered series of 3-nt-long units called codons that specify the order of amino acids
2021/1/21 1-1 polypeptide chains are specified by ORF 3- The protein coding region of each mRNA ∽ is composed of a contiguous, non overlapping string of codons called an opening reading frame (ORF) e- Each ORF begins with a start codon and ends with a stop codon AU GAAAG CAAUUUUCGUACU GA 0⑧0008③则③0③唧
2021/1/21 13 1-1 polypeptide chains are specified by ORF ◼ The protein coding region of each mRNA is composed of a contiguous, nonoverlapping string of codons called an opening reading frame (ORF) . ◼ Each ORF begins with a start codon and ends with a stop codon. Message RNA
2021/1/21 The start codon the first codon of an ore in bacteria:5-AUG-3′5′-GUG-3′or5′-UUG-3′ In eukaryotic cells: 5 -AUG-3 Functions: 1 specifies the first amino acid to be incorporated into the growing polypeptide chain 2. Defines the reading frame for all subsequent codons 14
2021/1/21 14 The start codon ——the first codon of an ORF In bacteria : 5’-AUG-3’ 5’-GUG-3’ or 5’-UUG-3’ In eukaryotic cells: 5’-AUG-3’ Functions: 1.Specifies the first amino acid to be incorporated into the growing polypeptide chain. 2.Defines the reading frame for all subsequent codons
Prokaryotic mRNA (polycistronic) 2021/1/21 stop RBS start 65ppp HBS start stop RBS start 0000 start top AUG T AAAAAn 3 5 cap 000000000000000000 Eukaryotic mRNA (monocistronic) 15
2021/1/21 15 Prokaryotic mRNA (polycistrionic) Eukaryotic mRNA (monocistrionic)
2021/1/21 5 A U GAAAG C AAU UU UCG UAC UGA AG G UUG GUGGC G CAC UUC CUGA R s stop 5 AUGAAAGCAAUUUUCGUACUGAAAGG UUG GUG CG C AC UUC CUGA 邮p⊙①③邮p(⑧②⑥③①巴 AUG AAAG CAAUUUUC G UA C UG A AA G GU UGG CGIC A CUUCICUGA ③③O③①0③①②③ Fig 14-1 Three possible reading frames of the e, coli trp leader sequence 16
2021/1/21 16 Fig 14-1 Three possible reading frames of the E. coli trp leader sequence