《生物化学原理》（英文版）chapter 8 NUCLEOTIDES AND NUCLEIC ACIDS

Chapter 9 DNA- Based Information Technologies ase and methylase activities. Type I restriction endon- Eukaryotic ceases cleave dna at random sites that can be more than 1,000 base pairs (bp) from the recognition se- ① Cloning vector DNA fragment of interest quence. Type Ill restriction endonucleases cleave the is cleaved with DNA about 25 bp from the recognition sequence. Bot estriction chromosome with a types move along the dna in a reaction that require restriction endonuclease the energy of ATP. Type II restriction endonucleases first isolated by Hamilton Smith in 1970, are simpler, re- to the prepared cloning quire no ATP, and cleave the DNA within the recogni- tion sequence itself. The extraordinary utility of this group of restriction endonucleases was demonstrated by Daniel Nathans, who first used them to develop novel DNA ligase methods for mapping and analyzing genes and genomes Thousands of restriction endonucleases have been discovered in different bacterial species, and more than Recombinant vector 100 different DNA sequences are recognized by one or more of these enzymes. The recognition sequences are ④ DNA is introduced usually 4 to 6 bp long and palindromic (see Fig 8-20) Table 9-2 lists sequences recognized by a few type Il restriction endonucleases. In some cases. the interac tion between a restriction endonuclease and its target sequence has been elucidated in exquisite molecular de- tail; for example, Figure 9-2 shows the complex of the type Il restriction endonuclease EcoRV and its target sequence Some restriction endonucleases make staggered oduces many copies cuts on the two DNA strands, leaving two to four nu- f recombinant DNA. cleotides of one strand unpaired at each resulting end. These unpaired strands are referred to as sticky ends (Fig. 9-3a), because they can base-pair with each other or with complementary sticky ends of other DNA frag ments. Other restriction endonucleases cleave both strands of DNa at the opposing phosphodiester bonds leaving no unpaired bases on the ends, often called blunt ends(Fig. 9-3b) The average size of the DNa fragments produced by cleaving genomic DNA with a restriction endonuclease depends on the frequency with which a particular re striction site occurs in the dna molecule this in turn FIGURE 9-1 Schematic illustration of DNA cloning. A cloning vec. depends largely on the size of the recognition sequence tor and eukaryotic chromosomes are separately cleaved with the same In a DNa molecule with a random sequence in which all restriction endonuclease. The fragments to be cloned are then ligated four nucleotides were equally abundant, a 6 bp sequence to the cloning vector. The resulting recombinant dNa (only one re- recognized by a restriction endonuclease such as BamHIl combinant vector is shown here) is introduced into a host cell where would occur on average once every 4(4, 096)bp,as- it can be propagated (cloned). Note that this drawing is not to scale: suming the dNa had a 50%G=C content. Enzymes that size of the E coli chromosome relative to that of a typical clonin recognize a 4 bp sequence would produce smaller DNA vector(such as a plasmid) is much greater than depicted here fragments from a random-sequence DNA molecule; a recognition sequence of this size would be expected to occur about once every 4"(256)bp. In natural DNA mol- y its own restriction endonuclease is protected from ecules, particular recognition sequences tend to occur digestion by methylation of the DNA, catalyzed by a spe- less frequently than this because nucleotide sequences cific DNA methylase. The restriction endonuclease and in DNA are not random and the four nucleotides are not the corresponding methylase are sometimes referred to equally abundant In laboratory experiments, the aver as a restriction-modification system. age size of the fragments produced by restriction en- There are three types of restriction endonucleases, donuclease cleavage of a large DNA can be increased by designated I, Il, and Ill. Types I and Il are generally large, simply terminating the reaction before completion; the multisubunit complexes containing both the endonucle- result is called a partial digest. Fragment size can also

by its own restriction endonuclease is protected from digestion by methylation of the DNA, catalyzed by a spe￾cific DNA methylase. The restriction endonuclease and the corresponding methylase are sometimes referred to as a restriction-modification system. There are three types of restriction endonucleases, designated I, II, and III. Types I and III are generally large, multisubunit complexes containing both the endonucle- 308 Chapter 9 DNA-Based Information Technologies Cloning vector is cleaved with restriction endonuclease. Cloning vector (plasmid) DNA is introduced into the host cell. Recombinant vector Eukaryotic chromosome DNA ligase DNA fragment of interest is obtained by cleaving chromosome with a restriction endonuclease. Fragments are ligated to the prepared cloning vector. 1 2 3 4 Propagation (cloning) produces many copies of recombinant DNA. 5 FIGURE 9–1 Schematic illustration of DNA cloning. A cloning vec￾tor and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. The fragments to be cloned are then ligated to the cloning vector. The resulting recombinant DNA (only one re￾combinant vector is shown here) is introduced into a host cell where it can be propagated (cloned). Note that this drawing is not to scale: the size of the E. coli chromosome relative to that of a typical cloning vector (such as a plasmid) is much greater than depicted here. ase and methylase activities. Type I restriction endonu￾cleases cleave DNA at random sites that can be more than 1,000 base pairs (bp) from the recognition se￾quence. Type III restriction endonucleases cleave the DNA about 25 bp from the recognition sequence. Both types move along the DNA in a reaction that requires the energy of ATP. Type II restriction endonucleases, first isolated by Hamilton Smith in 1970, are simpler, re￾quire no ATP, and cleave the DNA within the recogni￾tion sequence itself. The extraordinary utility of this group of restriction endonucleases was demonstrated by Daniel Nathans, who first used them to develop novel methods for mapping and analyzing genes and genomes. Thousands of restriction endonucleases have been discovered in different bacterial species, and more than 100 different DNA sequences are recognized by one or more of these enzymes. The recognition sequences are usually 4 to 6 bp long and palindromic (see Fig. 8–20). Table 9–2 lists sequences recognized by a few type II restriction endonucleases. In some cases, the interac￾tion between a restriction endonuclease and its target sequence has been elucidated in exquisite molecular de￾tail; for example, Figure 9–2 shows the complex of the type II restriction endonuclease EcoRV and its target sequence. Some restriction endonucleases make staggered cuts on the two DNA strands, leaving two to four nu￾cleotides of one strand unpaired at each resulting end. These unpaired strands are referred to as sticky ends (Fig. 9–3a), because they can base-pair with each other or with complementary sticky ends of other DNA frag￾ments. Other restriction endonucleases cleave both strands of DNA at the opposing phosphodiester bonds, leaving no unpaired bases on the ends, often called blunt ends (Fig. 9–3b). The average size of the DNA fragments produced by cleaving genomic DNA with a restriction endonuclease depends on the frequency with which a particular re￾striction site occurs in the DNA molecule; this in turn depends largely on the size of the recognition sequence. In a DNA molecule with a random sequence in which all four nucleotides were equally abundant, a 6 bp sequence recognized by a restriction endonuclease such as BamHI would occur on average once every 46 (4,096) bp, as￾suming the DNA had a 50% GmC content. Enzymes that recognize a 4 bp sequence would produce smaller DNA fragments from a random-sequence DNA molecule; a recognition sequence of this size would be expected to occur about once every 44 (256) bp. In natural DNA mol￾ecules, particular recognition sequences tend to occur less frequently than this because nucleotide sequences in DNA are not random and the four nucleotides are not equally abundant. In laboratory experiments, the aver￾age size of the fragments produced by restriction en￾donuclease cleavage of a large DNA can be increased by simply terminating the reaction before completion; the result is called a partial digest. Fragment size can also 8885d_c09_306-342 2/7/04 8:14 AM Page 308 mac76 mac76:385_reb:

9. 1 DNA Cloning: The Basics TABLE 9-2 Recognition Sequences for Some Type II Restriction Endonucleases BamhI 5)GGATCC(3) (5)AAGCTT(3) CCTAGG TTCGAA Clal (5ATCGAT(3) Notl (5)GCGGCCGC(3) TAGCTA CGCCGGCG (5)GAATTC(3) (5)CTGCAG(3) CTTAAG GACGTC 个 EcoRV (5)GATATC (3) PVI (5)CAGCTG(3) CTATAG GTCGAC (5)GGcc(3′) Tth1111 (5)GACNNNGTC(3) CCGG CTGNNNCAG Arrows indicate the phosphodiester bonds cleaved by each restriction endonuclease Asterisks indicate bases that are methylated by the corresponding ethylase(where known). N denotes any base. Note that the name of each enzyme consists of a three-letter abbreviation (in italics)of the bacterial ecies from which it is derived, sometimes followed by a strain designation and Roman numerals to distinguish different restriction endonucleases solated from the same bacterial species. Thus BamHI is the first ( restriction endonuclease characterized from Bacillus amyloliquefaciens, strain H. be increased by using a special class of endonuc HPLC. A common intermediate step in the cloning of a called homing endonucleases(see Fig. 26-34) specific gene or DNA segment is the construction of a recognize and cleave much longer DNA sequenc DNA library(as described in Section 9.2) to 20 bp) After the target DNa fragment is isolated, DNA lig Once a DNA molecule has been cleaved into frag- ase can be used to join it to a similarly digested cloning ments, a particular fragment of known size can be en- vector--that is, a vector digested by the same restric riched by agarose or acrylamide gel electrophoresis or tion endonuclease; a fragment generated by ecori, for by HPLC (pp 92, 90). For a typical mammalian genome, example, generally will not link to a fragment generated however, cleavage by a restriction endonuclease usually by BamHI. As described in more detail in Chapter 25 yields too many different DNA fragments to permit iso- (see Fig 25-16), DNA ligase catalyzes the formation of lation of a particular fragment by electrophoresis or new phosphodiester bonds in a reaction that uses ATP FIGURE 9-2 Interaction of ecorv restriction endonuclease with its target sequence. (a)Th dimeric EcoRV endonuclease(its two subunits of DNA cleavage at the sequence recognzey? blue and gray) is bound to the produe by the enzyme. The DNA backbone is shown in two shades of blue to distinguish the segments separated by cleavage(PDB ID 1RVO. (b)In this view, showing just the DNA, the DNA segment has been turned 180. The enzyme creates blunt ends; the on t DNA strands because the dna is kinked Bound magnesium ions (orange) play a role 8 Relysis of the cleavage reaction

be increased by using a special class of endonucleases called homing endonucleases (see Fig. 26–34). These recognize and cleave much longer DNA sequences (14 to 20 bp). Once a DNA molecule has been cleaved into frag￾ments, a particular fragment of known size can be en￾riched by agarose or acrylamide gel electrophoresis or by HPLC (pp. 92, 90). For a typical mammalian genome, however, cleavage by a restriction endonuclease usually yields too many different DNA fragments to permit iso￾lation of a particular fragment by electrophoresis or HPLC. A common intermediate step in the cloning of a specific gene or DNA segment is the construction of a DNA library (as described in Section 9.2). After the target DNA fragment is isolated, DNA lig￾ase can be used to join it to a similarly digested cloning vector—that is, a vector digested by the same restric￾tion endonuclease; a fragment generated by EcoRI, for example, generally will not link to a fragment generated by BamHI. As described in more detail in Chapter 25 (see Fig. 25–16), DNA ligase catalyzes the formation of new phosphodiester bonds in a reaction that uses ATP 9.1 DNA Cloning: The Basics 309 g * BamHI (5
) G G A T C C (3
) C C T A G G * h g * CIaI (5
) A T C G A T (3
) T A G C T A * h g * EcoRI (5
) G A A T T C (3
) C T T A A G * h g EcoRV (5
) G A T A T C (3
) C T A T A G h g * HaelII (5
) G G C C (3
) C C G G *h g HindIII (5
) A A G C T T (3
) T T C G A A h g Notl (5
) G C G G C C G C (3
) C G C C G G C G h * g Pstl (5
) C T G C A G (3
) G A C G T C h * g Pvull (5
) C A G C T G (3
) G T C G A C h g Tth111l (5
) G A C N N N G T C (3
) C T G N N N C A G h TABLE 9–2 Recognition Sequences for Some Type II Restriction Endonucleases Arrows indicate the phosphodiester bonds cleaved by each restriction endonuclease. Asterisks indicate bases that are methylated by the corresponding methylase (where known). N denotes any base. Note that the name of each enzyme consists of a three-letter abbreviation (in italics) of the bacterial species from which it is derived, sometimes followed by a strain designation and Roman numerals to distinguish different restriction endonucleases isolated from the same bacterial species. Thus BamHI is the first (I) restriction endonuclease characterized from Bacillus amyloliquefaciens, strain H. FIGURE 9–2 Interaction of EcoRV restriction endonuclease with its target sequence. (a) The dimeric EcoRV endonuclease (its two subunits in light blue and gray) is bound to the products of DNA cleavage at the sequence recognized by the enzyme. The DNA backbone is shown in two shades of blue to distinguish the segments separated by cleavage (PDB ID 1RVC). (b) In this view, showing just the DNA, the DNA segment has been turned 180. The enzyme creates blunt ends; the cleavage points appear staggered on the two DNA strands because the DNA is kinked. Bound magnesium ions (orange) play a role in catalysis of the cleavage reaction. Restriction Endonucleases (a) (b) 8885d_c09_306-342 2/7/04 8:14 AM Page 309 mac76 mac76:385_reb:

310 Chapter 9 DNA- Based Information Technologies Cleavage Cleavage sequences Chromosomal dNa -CCAIGAATTCAGCTTCGCATTAGCAGCTGTAGC- Gg TAAGTCGAAGCGTAATC G T CIGACATC EcoRl Pull GGTG AATTCAGCTTCGCATTAGCAG CTGTAG C --CCACTTAA GTCGAAGCGTAATCGTC GACATC FIGURE 9-3 Cleavage of DNA mole- Blunt ends cules by restriction endonucleases. Restriction endonucleases recognize and cleave only specific sequences, leaving either (a)sticky ends(with protruding single strands) or(b) blunt ends. Fragments can be ligated to DNA other DNAs, such as the cleaved cloning vector (a plasmid) shown here. This reaction is facilitated by the Plasmid annealing of complementary stic cloning vecto ends. Ligation is less efficient for EcoRI and pull DNA fragments with blunt ends than for those with complementary sticky ends, and dNA fragments with different(noncomplementary)sticky ends generally are not ligated (c) A synthetic DNA fragment with recognition sequences for several restriction endonucleases can be inserted into a plasmid that has been cleaved by a restriction endonuclease HindIll BamhI The insert is called a linker: an insert AATTCCTGCAGAAGCTTCCGGATCCCCGGG with multiple restriction sites is called G GACGTCTTCGAAGGCCTAGGGGCCCTTAA Synthetic polylinker or a similar cofactor. The base-pairing of complemen- tary sticky ends greatly facilitates the ligation reaction (Fig. 9-3a. Blunt ends can also be ligated, albeit less efficiently. Researchers can create new DNA sequel by inserting synthetic DNA fragments(called link between the ends that are being ligated Inserted DNA Plasmid cloning vector fragments with multiple recognition sequences for re- cleaved with EcoRI triction endonucleases(often useful later as points for inserting additional dna by cleavage and ligation) are alled polylinkers (Fig. 9-3c) The effectiveness of sticky ends in selectively join- ing two DNA fragments was apparent in the earliest recombinant DNA experiments Before restriction endo- nucleases were widely available, some workers found ey could generate sticky ends by the combined action of the bacteriophage A exonuclease and terminal trans ferase ( Table 9-1). The fragments to be joined were given complementary homopolymeric tails. Peter Lobban and Dale Kaiser used this method in 1971 in the first e periments to join naturally occurring DNA fragments

310 Chapter 9 DNA-Based Information Technologies G G T G A A T T C A G C T T C G C A T T A G C A G C T G T A G C C C A Cleavage site Cleavage site Recognition sequences Chromosomal DNA G G T G C C A C T T A A EcoRI restriction endonuclease PvuII restriction endonuclease G A A T T C A G C T T C G C A T T A G C A G G A C A T C G C T G T A G C Sticky ends Blunt ends DNA ligase Plasmid cloning vector cleaved with EcoRI and PvuII (a) (b) C T TAAGTC GAA C G G TAATC GTC GAC ATCG TCGAAGC GTAATC GTC A A T T C C T G C A G A A G C T T C C G G A T C C C C G G G G PstI Synthetic polylinker DNA ligase Plasmid cloning vector cleaved with EcoRI (c) HindIII BamHI SmaI GAC GT C T T CGAAGGC C T AGGGGC C C T T A A C T TAA G AAT T G C C T TAA G A AT T G C A A T T C G TT AA C G P Polylinker stI HindIII BamHI SmaI EcoRI FIGURE 9–3 Cleavage of DNA mole￾cules by restriction endonucleases. Restriction endonucleases recognize and cleave only specific sequences, leaving either (a) sticky ends (with protruding single strands) or (b) blunt ends. Fragments can be ligated to other DNAs, such as the cleaved cloning vector (a plasmid) shown here. This reaction is facilitated by the annealing of complementary sticky ends. Ligation is less efficient for DNA fragments with blunt ends than for those with complementary sticky ends, and DNA fragments with different (noncomplementary) sticky ends generally are not ligated. (c) A synthetic DNA fragment with recognition sequences for several restriction endonucleases can be inserted into a plasmid that has been cleaved by a restriction endonuclease. The insert is called a linker; an insert with multiple restriction sites is called a polylinker. or a similar cofactor. The base-pairing of complemen￾tary sticky ends greatly facilitates the ligation reaction (Fig. 9–3a). Blunt ends can also be ligated, albeit less efficiently. Researchers can create new DNA sequences by inserting synthetic DNA fragments (called linkers) between the ends that are being ligated. Inserted DNA fragments with multiple recognition sequences for re￾striction endonucleases (often useful later as points for inserting additional DNA by cleavage and ligation) are called polylinkers (Fig. 9–3c). The effectiveness of sticky ends in selectively join￾ing two DNA fragments was apparent in the earliest recombinant DNA experiments. Before restriction endo￾nucleases were widely available, some workers found they could generate sticky ends by the combined action of the bacteriophage
exonuclease and terminal trans￾ferase (Table 9–1). The fragments to be joined were given complementary homopolymeric tails. Peter Lobban and Dale Kaiser used this method in 1971 in the first ex￾periments to join naturally occurring DNA fragments. 8885d_c09_306-342 2/7/04 8:14 AM Page 310 mac76 mac76:385_reb:

9. 1 DNA Cloning: The Basics 311 Similar methods were used soon after in the laboratory EcoRI of Paul Berg to join DNA segments from simian virus 40 BamhI (Sv40)to DNA derived from bacteriophage A, thereby reating the first recombinant DNA molecule with DNa segments from different species Cloning Vectors Allow Amplification resistance resist of Inserted DNA Segments The principles that govern the delivery of recombinant DNA in clonable form to a host cell, and its subsequent (4,361bp) amplification in the host, are well illustrated by consid ering three popular cloning vectors commonly used in experiments with E. coli--plasmids, bacteriophages and bacterial artificial chromosomes--and a vector used to clone large DNa segments in yeast Plasmids Plasmids are circular dna molecules that Origin of replicate separately from the host chromosome Natu rally occurring bacterial plasmids range in size from Pull 5,000 to 400,000 bp. They can be introduced into bac- FIGURE 9-4 The constructed E coli plasmid pBR322. Note the lo- terial cells by a process called transformation. The cation of some important restriction sites--for Pstl, EcoRL, BamHI, Sa ells (generally E. coli) and plasmid DNA are incubated and Pvull; ampicillin- and tetracycline-resistance genes; and the repli- together at 0C in a calcium chloride solution, then sub- cation origin (ori). Constructed in 1977, this was one of the early plas- jected to a shock by rapidly shifting the temperature mids designed expressly for cloning in E. 37 to 43C. For reasons not well understood. some of the cells treated in this way take up the plasmid DNA. Some species of bacteria are naturally competent for allowing the identification of cells that contain the DNA uptake and do not require the calcium chloride intact plasmid or a recombinant version of the treatment. In an alternative method. cells incubated plasmid (Fig. 9-5) with the plasmid DNA are subjected to a high-voltage 3. Several unique recognition sequences in pBR322 pulse. This approach, called electroporation, tran (stl, EcoRL, BamHI, Sall, PuuD are targets fo siently renders the bacterial membrane permeable te different restriction endonucleases, providing sites large molecules where the plasmid can later be cut to insert for Regardless of the approach, few cells actually take eign DNA up the plasmid DNA, so a method is needed to select those that do. The usual strategy is to use a plasmid that The small size of the plasmid (4, 361 bp) facilitates includes a gene that the host cell requires for growth its entry into cells and the biochemical manipula under specific conditions, such as a gene that confers tion of the dna resistance to an antibiotic. Only cells transformed by the Transformation of typical bacterial cells with purified recombinant plasmid can grow in the presence of that DNA (never a very efficient process) becomes less suc antibiotic, making any cell that contains the plasmid"se cessful as plasmid size increases, and it is difficult to lectable"under those growth conditions. Such a gene is clone DNa segments longer than about 15, 000 bp when called a selectable marker plasmids are used as the vector. Investigators have developed many different plas nid vectors suitable for cloning by modifying naturally Bacteriophages Bacteriophage A has a very efficient occurring plasmids. The E. coli plasmid pBR322 offers mechanism for delivering its 48, 502 bp of DNA into a a good example of the features useful in a cloning vec- bacterium, and it can be used as a vector to clone some- tor(Fig. 9-4) what larger DNA segments(Fig. 9-6). Two key features contribute to its utility: 1. pBR322 has an origin of replication, ori, a sequence where replication is initiated by cellular 1. About one-third of the a genome is nonessential enzymes(Chapter 25). This sequence is required and can be replaced with foreign DNA to propagate the plasmid and maintain it at a level of 10 to 20 copies per cell 2. DNA is packaged into infectious phage particles only if it is between 40, 000 and 53, 000 bp long, a 2. The plasmid contains two genes that confer constraint that can be used to ensure packaging of resistance to different antibiotics (tetR, amp) recombinant DNA only

Similar methods were used soon after in the laboratory of Paul Berg to join DNA segments from simian virus 40 (SV40) to DNA derived from bacteriophage
, thereby creating the first recombinant DNA molecule with DNA segments from different species. Cloning Vectors Allow Amplification of Inserted DNA Segments The principles that govern the delivery of recombinant DNA in clonable form to a host cell, and its subsequent amplification in the host, are well illustrated by consid￾ering three popular cloning vectors commonly used in experiments with E. coli—plasmids, bacteriophages, and bacterial artificial chromosomes—and a vector used to clone large DNA segments in yeast. Plasmids Plasmids are circular DNA molecules that replicate separately from the host chromosome. Natu￾rally occurring bacterial plasmids range in size from 5,000 to 400,000 bp. They can be introduced into bac￾terial cells by a process called transformation. The cells (generally E. coli) and plasmid DNA are incubated together at 0 C in a calcium chloride solution, then sub￾jected to a shock by rapidly shifting the temperature to 37 to 43 C. For reasons not well understood, some of the cells treated in this way take up the plasmid DNA. Some species of bacteria are naturally competent for DNA uptake and do not require the calcium chloride treatment. In an alternative method, cells incubated with the plasmid DNA are subjected to a high-voltage pulse. This approach, called electroporation, tran￾siently renders the bacterial membrane permeable to large molecules. Regardless of the approach, few cells actually take up the plasmid DNA, so a method is needed to select those that do. The usual strategy is to use a plasmid that includes a gene that the host cell requires for growth under specific conditions, such as a gene that confers resistance to an antibiotic. Only cells transformed by the recombinant plasmid can grow in the presence of that antibiotic, making any cell that contains the plasmid “se￾lectable” under those growth conditions. Such a gene is called a selectable marker. Investigators have developed many different plas￾mid vectors suitable for cloning by modifying naturally occurring plasmids. The E. coli plasmid pBR322 offers a good example of the features useful in a cloning vec￾tor (Fig. 9–4): 1. pBR322 has an origin of replication, ori, a sequence where replication is initiated by cellular enzymes (Chapter 25). This sequence is required to propagate the plasmid and maintain it at a level of 10 to 20 copies per cell. 2. The plasmid contains two genes that confer resistance to different antibiotics (tetR , ampR ), allowing the identification of cells that contain the intact plasmid or a recombinant version of the plasmid (Fig. 9–5). 3. Several unique recognition sequences in pBR322 (PstI, EcoRI, BamHI, SalI, PvuII) are targets for different restriction endonucleases, providing sites where the plasmid can later be cut to insert for￾eign DNA. 4. The small size of the plasmid (4,361 bp) facilitates its entry into cells and the biochemical manipula￾tion of the DNA. Transformation of typical bacterial cells with purified DNA (never a very efficient process) becomes less suc￾cessful as plasmid size increases, and it is difficult to clone DNA segments longer than about 15,000 bp when plasmids are used as the vector. Bacteriophages Bacteriophage
has a very efficient mechanism for delivering its 48,502 bp of DNA into a bacterium, and it can be used as a vector to clone some￾what larger DNA segments (Fig. 9–6). Two key features contribute to its utility: 1. About one-third of the
genome is nonessential and can be replaced with foreign DNA. 2. DNA is packaged into infectious phage particles only if it is between 40,000 and 53,000 bp long, a constraint that can be used to ensure packaging of recombinant DNA only. 9.1 DNA Cloning: The Basics 311 Ampicillin resistance (ampR) Tetracycline resistance (tetR) Origin of replication (ori) PvuII SalI BamHI EcoRI PstI pBR322 (4,361bp) FIGURE 9–4 The constructed E. coli plasmid pBR322. Note the lo￾cation of some important restriction sites—for PstI, EcoRI, BamHI, SalI, and PvuII; ampicillin- and tetracycline-resistance genes; and the repli￾cation origin (ori). Constructed in 1977, this was one of the early plas￾mids designed expressly for cloning in E. coli. 8885d_c09_306-342 2/7/04 8:14 AM Page 311 mac76 mac76:385_reb:

restriction 22 is cleaved at the ampicillin PstI restriction resistance element by PstI. Filler DNa(not needed Foreign DNa Foreign DNA is ligated to cleaved pBR322. Where ligation DNA ligase ligase element remains intact Lack essential dna oos and/or are too small Recombinant dnas to be package E. coli cells are transformed ther transformation grown on agar plates containing tetracycline to select for those that of E. coli cells have taken up plasmid. DNA a e chaining orign dna trans formed cells FIGURE 9-6 Bacteriophage A cloning vectors. Recombinant DNA methods are used to modify the bacteriophage A genome, removing he genes not needed for phage production and replacing them with filler"DNA to make the phage DNA large enough for packaging into Individual colonies are transferred phage particles. As shown here, the filler is replaced with foreign DNA to matching positions on additional colonies transferred plates. One plate contains tetracycline, for testing in cloning experiments. Recombinants are packaged into viable phage the other tetracycline and ampicillin. particles in vitro only if they include an appropriately sized foreign Colonies with DNA fragment as well as both of the essential A DNA end fragments Researchers have developed bacteriophage a vec tors that can be readily cleaved into three pieces, two of which contain essential genes but which together are only about 30,000 bp long. The third piece, filler"DNA, Agar containing is discarded when the vector is to be used for cloning bicillin tetracycline and additional dna is inserted between the two essen- tial segments to generate ligated DNA molecules long Cells that grow on but not on tetracycline enough to produce viable phage particles. In effect, the ampicillin contain packaging mechanism selects for recombinant viral foreign DNA. Cells with pBR322 DNAS without foreign DNA retain ampicillin resistance and grow or both plates Bacteriophage A vectors permit the cloning of DNA fragments of up to 23, 000 bp. Once the bacteriophage FIGURE 9-5 Use of pBR322 to clone and identify foreign DNA in A fragments are ligated to foreign DNA fragments of suit E. col able size, the resulting recombinant DNAs can be pack

Researchers have developed bacteriophage
vec￾tors that can be readily cleaved into three pieces, two of which contain essential genes but which together are only about 30,000 bp long. The third piece, “filler” DNA, is discarded when the vector is to be used for cloning, and additional DNA is inserted between the two essen￾tial segments to generate ligated DNA molecules long enough to produce viable phage particles. In effect, the packaging mechanism selects for recombinant viral DNAs. Bacteriophage
vectors permit the cloning of DNA fragments of up to 23,000 bp. Once the bacteriophage
fragments are ligated to foreign DNA fragments of suit￾able size, the resulting recombinant DNAs can be pack￾PstI restriction endonuclease pBR322 amp plasmids R tetR Foreign DNA DNA ligase Agar containing tetracycline (control) Colonies with recombinant plasmids Host DNA transformation of E. coli cells 2 Foreign DNA is ligated to cleaved pBR322. Where ligation is successful, the ampicillin-resistance element is disrupted. The tetracycline-resistance element remains intact. 1 pBR322 is cleaved at the ampicillin￾resistance element by PstI. 3 E. coli cells are transformed, then grown on agar plates containing tetracycline to select for those that have taken up plasmid. 4 Individual colonies are transferred to matching positions on additional plates. One plate contains tetracycline, the other tetracycline and ampicillin. 5 Cells that grow on tetracycline but not on tetracycline + ampicillin contain recombinant plasmids with disrupted ampicillin resistance, hence the foreign DNA. Cells with pBR322 without foreign DNA retain ampicillin resistance and grow on both plates. Agar containing tetracycline Agar containing ampicillin + tetracycline All colonies have plasmids selection of transformed cells colonies transferred for testing FIGURE 9–5 Use of pBR322 to clone and identify foreign DNA in E. coli. Plasmid Cloning restriction endonuclease Filler DNA (not needed for packaging) Lack essential DNA and/or are too small Recombinant DNAs to be packaged DNA ligase in vitro packaging λ bacteriophage containing foreign DNA Foreign DNA fragments FIGURE 9–6 Bacteriophage
cloning vectors. Recombinant DNA methods are used to modify the bacteriophage
genome, removing the genes not needed for phage production and replacing them with “filler” DNA to make the phage DNA large enough for packaging into phage particles. As shown here, the filler is replaced with foreign DNA in cloning experiments. Recombinants are packaged into viable phage particles in vitro only if they include an appropriately sized foreign DNA fragment as well as both of the essential
DNA end fragments. 8885d_c09_306-342 2/7/04 8:14 AM Page 312 mac76 mac76:385_reb: