《生物化学原理》（英文版）chapter 8 NUCLEOTIDES AND NUCLEIC ACIDS

Chapter 8 Problems 303 Further Reading General Variations in DNA Structure Chang, KY& Varani, G.(1997) Nucleic acids structure and Frank- Kamenetskii, M D. Mirkin, S.M. (1995)Triplex DNA recognition. Nat. Struct. Biol. 4(Suppl ) 854-858 structures. Annu. Rev. Biochem. 64 65-95 Describes the application of NMr to determination of nucleic Herbert, A.& Rich, A.(1996) The biology of left-handed Z-DNA. acid structure J. Biol.Chem27,11,595-11.598 Friedberg,EC, Walker, G.C.& Siede, W(1995) DNA Repair Htun, H.& Dahlberg, J E(1989) Topology and formation of and Mutagenesis, W H. Freeman and Company, New York. a good source for more information on the chemistry of triple-stranded H-DNA. Science 243, 1571-1576 nucleotides and nucleic acids. Keniry, M A(2000)Quadruplex structures in nucleic acids Hecht, S M (ed )(1996) Bioorganic Chemistry: Nucleic Acids. Biopolymers 56, 123-146 Good summary of the structural properties of quadruplexes. Oxford University Press, Oxford. A very useful set of articles Moore, PB(1999) Structural motifs in RNA. Annu. Rev iachen68,287-300 Kornberg, A.& Baker, T.A.(1991)DNA Replication, 2nd edn., W.H. Freeman and Company, New York. Shafer, R..(1998)Stability and structure of model dNA The best place to start to lean more about DNA structure. triplexes and quadruplexes and their interactions with small Sinden, R. R(1994)DNA Structure and Function,, Academic ligands. Prog. Nucleic Acid Res. Mol. Biol. 59, 55-94 Press, Inc., San Diego. Wells, R D.(1988) Unusual DNA structures. J. Biol Chem. 263 Good discussion of many topics covered in this chapter. 1095-1098 Historical Judson,HE(1996)The Eighth Day of Creation: Makers of the Nucleic Acid Chemistry Revolution in Biology, expanded edn, Cold Spring Harbor Collins, A R. (1999)Oxidative DNA damage, antioxidants, and Laboratory Press, Cold Spring Harbor, NY. Olby, RC.(1994)The Path to the Double Helix: The Discovery Marnett, L.J. Plastaras, J. P.(2001) Endogenous of DNA, Dover Publications, Inc, New York. damage and mutation. Trends Genet. 17, 214-221. Sayre, A.(1978)Rosalind Franklin and DNA, W.W. Norton& ATP As Energy Carrier Co. Inc. New York Jencks, W.P.( 1987) Economics of enzyme catalysis. Cold Spring Watson, J D(1968)The Double Helix: A Personal Account of Harb. Symp. Quant. Biol. 52, 65-73 the Discovery of the Structure of DNA, Atheneum, New York. A relatively short article, full of insights PAperback edition. Touchstone Books, 2001.1 Problems 1. Nucleotide Structure Which positions in a purine the total (net) bend produced in a DNA if the center base ring of a purine nucleotide in DNA have the potential to form pairs(the third of five)of two successive(dA)s tracts are lo- hydrogen bonds but are not involved in Watson-Crick base cated(a)10 base pairs apart; (b)15 base pairs apart. As sume 10 base pairs per turn in the DNA double helix 2. Base Sequence of Complementary DNA Strand 5. Distinction between DNa Structure and rna One strand of a double-helical dna has the Structure Hairpins may form at palindromic sequences in (5")GCGCAATATTTCTCAAAATATTGCGC(3). Write the base single strands of either RNA or DNA. How is the helical struc sequence of the complementary strand. What special type of ture of a long and fully base-paired (except at the end) hair- uence is contained in this DNA segment? Does the dou- pin in RNa different from that of a similar hairpin in DNA ble-stranded DNA have the potential to form any alternative structures 6. Nucleotide Chemistry The cells of many eukaryotic organisms have highly specialized systems that specifically 3. DNA of the Human Body Calculate the weight in repair G-T mismatches in DNA. The mismatch is repaired to grams of a double-helical DNA molecule stretching from the form a G=C (not A-D)base pair. This G-T mismatch repair earth to the moon (-320,000 km). The DNA double helix mechanism occurs in addition to a more general system that weighs about 1 x 10- g per 1,000 nucleotide pairs; each virtually all mismatches. Can you suggest why cells base pair extends 3.4 A For an interesting comparison, your might require a specialized system to repair G-Tmismatches? body contains about 0.5 g of DNAI 7. Nucleic Acid Structure Explain why the absorption 4. DNA Bending Assume that a poly(A) tract five base of UV light by double-stranded DNA increases(hyperchromic pairs long produces a 20 bend in a DNA strand. Calculate effect) when the DNA is denatured

Chapter 8 Problems 303 Further Reading General Chang, K.Y. & Varani, G. (1997) Nucleic acids structure and recognition. Nat. Struct. Biol. 4 (Suppl.), 854–858. Describes the application of NMR to determination of nucleic acid structure. Friedberg, E.C., Walker, G.C., & Siede, W. (1995) DNA Repair and Mutagenesis, W. H. Freeman and Company, New York. A good source for more information on the chemistry of nucleotides and nucleic acids. Hecht, S.M. (ed.) (1996) Bioorganic Chemistry: Nucleic Acids, Oxford University Press, Oxford. A very useful set of articles. Kornberg, A. & Baker, T.A. (1991) DNA Replication, 2nd edn, W. H. Freeman and Company, New York. The best place to start to learn more about DNA structure. Sinden, R.R. (1994) DNA Structure and Function, Academic Press, Inc., San Diego. Good discussion of many topics covered in this chapter. Historical Judson, H.F. (1996) The Eighth Day of Creation: Makers of the Revolution in Biology, expanded edn, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Olby, R.C. (1994) The Path to the Double Helix: The Discovery of DNA, Dover Publications, Inc., New York. Sayre, A. (1978) Rosalind Franklin and DNA, W. W. Norton & Co., Inc., New York. Watson, J.D. (1968) The Double Helix: A Personal Account of the Discovery of the Structure of DNA, Atheneum, New York. [Paperback edition, Touchstone Books, 2001.] Variations in DNA Structure Frank-Kamenetskii, M.D. & Mirkin, S.M. (1995) Triplex DNA structures. Annu. Rev. Biochem. 64, 65–95. Herbert, A. & Rich, A. (1996) The biology of left-handed Z-DNA. J. Biol. Chem. 271, 11,595–11,598. Htun, H. & Dahlberg, J.E. (1989) Topology and formation of triple-stranded H-DNA. Science 243, 1571–1576. Keniry, M.A. (2000) Quadruplex structures in nucleic acids. Biopolymers 56, 123–146. Good summary of the structural properties of quadruplexes. Moore, P.B. (1999) Structural motifs in RNA. Annu. Rev. Biochem. 68, 287–300. Shafer, R.H. (1998) Stability and structure of model DNA triplexes and quadruplexes and their interactions with small ligands. Prog. Nucleic Acid Res. Mol. Biol. 59, 55–94. Wells, R.D. (1988) Unusual DNA structures. J. Biol. Chem. 263, 1095–1098. Minireview; a concise summary. Nucleic Acid Chemistry Collins, A.R. (1999) Oxidative DNA damage, antioxidants, and cancer. Bioessays 21, 238–246. Marnett, L.J. & Plastaras, J.P. (2001) Endogenous DNA damage and mutation. Trends Genet. 17, 214–221. ATP As Energy Carrier Jencks, W.P. (1987) Economics of enzyme catalysis. Cold Spring Harb. Symp. Quant. Biol. 52, 65–73. A relatively short article, full of insights. 1. Nucleotide Structure Which positions in a purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing? 2. Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (5
)GCGCAATATTTCTCAAAATATTGCGC(3
). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the dou￾ble-stranded DNA have the potential to form any alternative structures? 3. DNA of the Human Body Calculate the weight in grams of a double-helical DNA molecule stretching from the earth to the moon (~320,000 km). The DNA double helix weighs about 1  1018 g per 1,000 nucleotide pairs; each base pair extends 3.4 Å. For an interesting comparison, your body contains about 0.5 g of DNA! 4. DNA Bending Assume that a poly(A) tract five base pairs long produces a 20 bend in a DNA strand. Calculate the total (net) bend produced in a DNA if the center base pairs (the third of five) of two successive (dA)5 tracts are lo￾cated (a) 10 base pairs apart; (b) 15 base pairs apart. As￾sume 10 base pairs per turn in the DNA double helix. 5. Distinction between DNA Structure and RNA Structure Hairpins may form at palindromic sequences in single strands of either RNA or DNA. How is the helical struc￾ture of a long and fully base-paired (except at the end) hair￾pin in RNA different from that of a similar hairpin in DNA? 6. Nucleotide Chemistry The cells of many eukaryotic organisms have highly specialized systems that specifically repair G–T mismatches in DNA. The mismatch is repaired to form a GqC (not AUT) base pair. This G–T mismatch repair mechanism occurs in addition to a more general system that repairs virtually all mismatches. Can you suggest why cells might require a specialized system to repair G–T mismatches? 7. Nucleic Acid Structure Explain why the absorption of UV light by double-stranded DNA increases (hyperchromic effect) when the DNA is denatured. Problems

304 Chapter 8 Nucleotides and Nucleic Acids 8. Determination of Protein Concentration in a So 11. DNA Sequencing The following DNA fragment was lution Containing Proteins and Nucleic Acids The con- sequenced by the Sanger method. The red asterisk indicates centration of protein or nucleic acid in a solution con both can be estimated by using their different light absorp- tion properties: proteins absorb most strongly at 280 nm and *.0H lucleic acids at 260 nm. Their respective concentrations in a ATTACGCAAGGACATTAGACud mixture can be estimated by measuring the absorbance(A) A sample of the DNa was reacted with DNA polymerase and of the solution at 280 nm and 260 nm and using the table be- each of the nucleotide mixtures(in an appropriate buffer) low, which gives R2so26o the ratio of absorbances at 280 and listed below. Dideoxynucleotides(ddNTPs)were added in 260 nm; the percentage of total mass that is nucleic acid; and relatively small amounts. a factor, F, that corrects the A280 reading and gives a more accurate protein estimate. The protein concentration (in 1. datp dttp dctp dgtP. ddTTP mg/ml)= FX A2so(assuming the cuvette is I cm wide). Cal- 2. datp dttp dcte dgtp ddgTP culate the protein concentration in a solution of A280=0.69 3. datp dctp dgtp ddTtp andA26=094 4. datp dttp dctP dGTP Proportion af oleic acid( %) The resulting DNA was separated by electrophoresis on an agarose gel, and the fluorescent bands on the gel were 000 1.116 located. The band pattern resulting from nucleotide mixture I is shown below. Assuming that all mixtures were run on the 1.05 same gel, what did the remaining lanes of the gel look like? 0.75 100 0899 9 50 0.852 3.00 0.814 3.50 0.939 0.743 0.874 0.682 0.656 0.822 600 0.632 0.804 6.50 0.607 750 0.730 900 0.508 0.705 0.478 1200 12. Snake Venom Phosphodiesterase An exonuclease is 0.644 1400 0.377 1700 an enzyme that sequentially cleaves nucleotides from the end of a polynucleotide strand. Snake venom phosphodiesterase, 0.595 2000 0.278 which hydrolyzes nucleotides from the 3 end of any oligont cleotide with a free 3-hydroxyl group, cleaves between the 9. Base Pairing in DNA In samples of DNA isolated from 3 hydroxyl of the ribose or deoxyribose and the phosphoryl two unidentified species of bacteria, X and Y, adenine makes group of the next nucleotide. It acts on single-stranded DNA up 32% and 17%6, respectively, of the total bases. What rela- or RNA and has no base specificity. This enzyme was used in tive proportions of adenine, guanine, thymine, and cytosine would you expect to find in the two DNA samples? What of modern nucleic acid sequencing techniques. What are the sumptions have you made? One of these species was isolated products of partial digestion by snake venom phosphodi- from a hot spring(64"C) Suggest which species is the ther- esterase of an oligonucleotide with the following sequence? mophilic bacterium. What is the basis for your answer? 10. Solubility of the Components of DNa Draw the fol- 13. Preserving DNA in Bacterial Endospores Bacter- lowing structures and rate their relative solubilities in water ial endospores form when the environment is no longer con- (most soluble to least soluble): deoxyribose, guanine, phos- ducive to active cell metabolism. The soil bacterium Bacillus phate. How are these solubilities consistent with the three- subtilis, for example, begins the process of sporulation when dimensional structure of double-stranded dna? one or more nutrients are depleted. The end product is a

304 Chapter 8 Nucleotides and Nucleic Acids 8. Determination of Protein Concentration in a So￾lution Containing Proteins and Nucleic Acids The con￾centration of protein or nucleic acid in a solution containing both can be estimated by using their different light absorp￾tion properties: proteins absorb most strongly at 280 nm and nucleic acids at 260 nm. Their respective concentrations in a mixture can be estimated by measuring the absorbance (A) of the solution at 280 nm and 260 nm and using the table be￾low, which gives R280/260, the ratio of absorbances at 280 and 260 nm; the percentage of total mass that is nucleic acid; and a factor, F, that corrects the A280 reading and gives a more accurate protein estimate. The protein concentration (in mg/ml)  F  A280 (assuming the cuvette is 1 cm wide). Cal￾culate the protein concentration in a solution of A280  0.69 and A260  0.94. 9. Base Pairing in DNA In samples of DNA isolated from two unidentified species of bacteria, X and Y, adenine makes up 32% and 17%, respectively, of the total bases. What rela￾tive proportions of adenine, guanine, thymine, and cytosine would you expect to find in the two DNA samples? What as￾sumptions have you made? One of these species was isolated from a hot spring (64 C). Suggest which species is the ther￾mophilic bacterium. What is the basis for your answer? 10. Solubility of the Components of DNA Draw the fol￾lowing structures and rate their relative solubilities in water (most soluble to least soluble): deoxyribose, guanine, phos￾phate. How are these solubilities consistent with the three￾dimensional structure of double-stranded DNA? 11. DNA Sequencing The following DNA fragment was sequenced by the Sanger method. The red asterisk indicates a fluorescent label. A sample of the DNA was reacted with DNA polymerase and each of the nucleotide mixtures (in an appropriate buffer) listed below. Dideoxynucleotides (ddNTPs) were added in relatively small amounts. 1. dATP, dTTP, dCTP, dGTP, ddTTP 2. dATP, dTTP, dCTP, dGTP, ddGTP 3. dATP, dCTP, dGTP, ddTTP 4. dATP, dTTP, dCTP, dGTP The resulting DNA was separated by electrophoresis on an agarose gel, and the fluorescent bands on the gel were located. The band pattern resulting from nucleotide mixture 1 is shown below. Assuming that all mixtures were run on the same gel, what did the remaining lanes of the gel look like? 12. Snake Venom Phosphodiesterase An exonuclease is an enzyme that sequentially cleaves nucleotides from the end of a polynucleotide strand. Snake venom phosphodiesterase, which hydrolyzes nucleotides from the 3
end of any oligonu￾cleotide with a free 3
-hydroxyl group, cleaves between the 3
hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single-stranded DNA or RNA and has no base specificity. This enzyme was used in sequence determination experiments before the development of modern nucleic acid sequencing techniques. What are the products of partial digestion by snake venom phosphodi￾esterase of an oligonucleotide with the following sequence? (5
)GCGCCAUUGC(3
)–OH 13. Preserving DNA in Bacterial Endospores Bacter￾ial endospores form when the environment is no longer con￾ducive to active cell metabolism. The soil bacterium Bacillus subtilis, for example, begins the process of sporulation when one or more nutrients are depleted. The end product is a Proportion of R280/260 nucleic acid (%) F 1.75 0.00 1.116 1.63 0.25 1.081 1.52 0.50 1.054 1.40 0.75 1.023 1.36 1.00 0.994 1.30 1.25 0.970 1.25 1.50 0.944 1.16 2.00 0.899 1.09 2.50 0.852 1.03 3.00 0.814 0.979 3.50 0.776 0.939 4.00 0.743 0.874 5.00 0.682 0.846 5.50 0.656 0.822 6.00 0.632 0.804 6.50 0.607 0.784 7.00 0.585 0.767 7.50 0.565 0.753 8.00 0.545 0.730 9.00 0.508 0.705 10.00 0.478 0.671 12.00 0.422 0.644 14.00 0.377 0.615 17.00 0.322 0.595 20.00 0.278

Chapter 8 Problems 30 small, metabolically dormant structure that can survive al- Open the structures using RasMol or Chime, and use the dif- most indefinitely with no detectable metabolism. Spores have ferent viewing options to complete the following exercises. mechanisms to prevent accumulation of potentially lethal mu- (a)Obtain the file for 141D, a highly conserved, re- tations in their DNA over periods of dormancy that can ex- peated DNA sequence from the end of the HIv-1( the virus eed 1,000 years. B subtilis spores are much more resistant that causes AIDS) genome. Display the molecule as a sti than the organisms growing cells to heat, UV radiation, and or ball-and-stick structure. Identify the sugar-phosphate xidizing agents, all of which promote mutations. backbone for each strand of the DNA duplex Locate and iden- po(a)One factor that prevents potential dna damage in tify individual bases. Which is the 5'end of this molecule? es is their greatly decreased water content. How would Locate the major and minor grooves. Is this a right-or left this affect some types of mutations? ) Endospores have a category of proteins called small b)Obtain the file for 145D, a dna with the Z confor id-soluble proteins(SASPs)that bind to their DNA, pre- mation Display the molecule as a stick or ball-and-stick struc venting formation of cyclobutane-type dimers. What causes ture. Identify the sugar-phosphate backbone for each strand cyclobutane dimers, and why do bacterial endospores need of the DNA duplex. Is this a right- or left-handed helix? mechanisms to prevent their formation? select"Stereo'in the Options menu in the viewer. Jou A Biochemistry on the Internet see two images of the DNA molecule. Sit with your nose ap- 14. The Structure of DNA Elucidation of the three- proximately 10 inches from the monitor and focus on the tip dimensional structure of DNA helped researchers understand of your nose. In the background you should see three images how this molecule conveys information that can be of the DNA helix. Shift your focus from the tip of your nose replicated from one generation to the next. To see the second- to the middle image, which should appear three-dimensional ary structure of double-stranded DNA, go to the Protein Data (Note that only one of the two authors can make this work Bankwebsite(www.rcsb.org/pdb).UsethePdbidentifiersForadditionaltipsseetheStudyGuideorthetextbookweb listedbelowtoretrievethedatapagesforthetwoformsofDnasite(www.whfreeman.com/lehninger)

Chapter 8 Problems 305 small, metabolically dormant structure that can survive al￾most indefinitely with no detectable metabolism. Spores have mechanisms to prevent accumulation of potentially lethal mu￾tations in their DNA over periods of dormancy that can ex￾ceed 1,000 years. B. subtilis spores are much more resistant than the organism’s growing cells to heat, UV radiation, and oxidizing agents, all of which promote mutations. (a) One factor that prevents potential DNA damage in spores is their greatly decreased water content. How would this affect some types of mutations? (b) Endospores have a category of proteins called small acid-soluble proteins (SASPs) that bind to their DNA, pre￾venting formation of cyclobutane-type dimers. What causes cyclobutane dimers, and why do bacterial endospores need mechanisms to prevent their formation? Biochemistry on the Internet 14. The Structure of DNA Elucidation of the three￾dimensional structure of DNA helped researchers understand how this molecule conveys information that can be faithfully replicated from one generation to the next. To see the second￾ary structure of double-stranded DNA, go to the Protein Data Bank website (www.rcsb.org/pdb). Use the PDB identifiers listed below to retrieve the data pages for the two forms of DNA. Open the structures using RasMol or Chime, and use the dif￾ferent viewing options to complete the following exercises. (a) Obtain the file for 141D, a highly conserved, re￾peated DNA sequence from the end of the HIV-1 (the virus that causes AIDS) genome. Display the molecule as a stick or ball-and-stick structure. Identify the sugar–phosphate backbone for each strand of the DNA duplex. Locate and iden￾tify individual bases. Which is the 5
end of this molecule? Locate the major and minor grooves. Is this a right- or left￾handed helix? (b) Obtain the file for 145D, a DNA with the Z confor￾mation. Display the molecule as a stick or ball-and-stick struc￾ture. Identify the sugar–phosphate backbone for each strand of the DNA duplex. Is this a right- or left-handed helix? (c) To fully appreciate the secondary structure of DNA, select “Stereo” in the Options menu in the viewer. You will see two images of the DNA molecule. Sit with your nose ap￾proximately 10 inches from the monitor and focus on the tip of your nose. In the background you should see three images of the DNA helix. Shift your focus from the tip of your nose to the middle image, which should appear three-dimensional. (Note that only one of the two authors can make this work.) For additional tips, see the Study Guide or the textbook web￾site (www.whfreeman.com/lehninger)

●●●4●●● ●●●4●●●● chapter 000000●● DNA-BASED INFORMATION TECHNOLOGIES 9.1 DNA Cloning: The Basics 306 ents an enormous challenge: how does one find and 9.2 From Genes to genomes 317 study a particular gene among the tens of thousands of genes nested in the billions of base pairs of a mammalian 9. 3 From Genomes to proteomes 325 genome? Solutions began to emerge in the 197( 9.4 Genome Alterations and new products Decades of advances by thousands of scientists of Biotechnology 330 working in genetics, biochemistry, cell biology, and phys ical chemistry came together in the laboratories of Paul Berg, Herbert Boyer, and Stanley Cohen to yield tech- Of all the natural systems, living matter is the one which niques for locating, isolating, preparing, and studying in the face of great transformations, preserves inscribed in small segments of DNA derived from much larger chro its organization the largest amount of its own past history. mosomes. Techniques for dna cloning paved the way -Emile Zuckerkandl and Linus Pauling, article in Journal to the modern fields of genomics and proteomics, the of Theoretical Biology, 1965 study of genes and proteins on the scale of whole cells and organisms. These new methods are transforming ba- sic research, agriculture, medicine, ecology, forensics e now turn to a technology that is fundamental and many other fields, while occasionally presenting so to the advance of modern biological sciences, defin- ciety with difficult choices and ethical dilemmas ing present and future biochemical frontiers and illus- We begin this chapter with an outline of the funda- trating many important principles of biochemistry Iner ntal biochemical principles of the now-classic disci Elucidation of the laws governing enzymatic catalysis, pline of DNA cloning. Next, after laying the groundwork macromolecular structure, cellular metabolism, and in- for a discussion of genomics, we illustrate the range of formation pathways allows research to be directed at in- applications and the potential of these technologies creasingly complex biochemical processes. Cell division, with a broad emphasis on modern advances in genomics immunity, embryogenesis, vision, taste, oncogenesis, and proteomics cognition-all are orchestrated in an elaborate sym- phony of molecular and macromolecular interactions that we are now beginning to understand with increasing 9.1 DNA Cloning: The Basics larity. The real implications of the biochemical journey begun in the nineteenth century are found in the ever- A clone is an identical copy. This term originally applied increasing power to analyze and alter living systems. to cells of a single type, isolated and allowed to repro- To understand a complex biological process, a bio- duce to create a population of identical cells. DNA chemist isolates and studies the individual components cloning involves separating a specific gene or DNA seg- in vitro, then pieces together the parts to get a coher- ment from a larger chromosome, attaching it to a small ent picture of the overall process. A major source of mo- molecule of carrier DNA, and then replicating this mod- lecular insights is the cells own information archive, its ified dna thousands or millions of times through both DNA. The sheer size of chromosomes, however, pres- an increase in cell number and the creation of multiple 306

chapter We now turn to a technology that is fundamental to the advance of modern biological sciences, defin￾ing present and future biochemical frontiers and illus￾trating many important principles of biochemistry. Elucidation of the laws governing enzymatic catalysis, macromolecular structure, cellular metabolism, and in￾formation pathways allows research to be directed at in￾creasingly complex biochemical processes. Cell division, immunity, embryogenesis, vision, taste, oncogenesis, cognition—all are orchestrated in an elaborate sym￾phony of molecular and macromolecular interactions that we are now beginning to understand with increasing clarity. The real implications of the biochemical journey begun in the nineteenth century are found in the ever￾increasing power to analyze and alter living systems. To understand a complex biological process, a bio￾chemist isolates and studies the individual components in vitro, then pieces together the parts to get a coher￾ent picture of the overall process. A major source of mo￾lecular insights is the cell’s own information archive, its DNA. The sheer size of chromosomes, however, pres￾ents an enormous challenge: how does one find and study a particular gene among the tens of thousands of genes nested in the billions of base pairs of a mammalian genome? Solutions began to emerge in the 1970s. Decades of advances by thousands of scientists working in genetics, biochemistry, cell biology, and phys￾ical chemistry came together in the laboratories of Paul Berg, Herbert Boyer, and Stanley Cohen to yield tech￾niques for locating, isolating, preparing, and studying small segments of DNA derived from much larger chro￾mosomes. Techniques for DNA cloning paved the way to the modern fields of genomics and proteomics, the study of genes and proteins on the scale of whole cells and organisms. These new methods are transforming ba￾sic research, agriculture, medicine, ecology, forensics, and many other fields, while occasionally presenting so￾ciety with difficult choices and ethical dilemmas. We begin this chapter with an outline of the funda￾mental biochemical principles of the now-classic disci￾pline of DNA cloning. Next, after laying the groundwork for a discussion of genomics, we illustrate the range of applications and the potential of these technologies, with a broad emphasis on modern advances in genomics and proteomics. 9.1 DNA Cloning: The Basics A clone is an identical copy. This term originally applied to cells of a single type, isolated and allowed to repro￾duce to create a population of identical cells. DNA cloning involves separating a specific gene or DNA seg￾ment from a larger chromosome, attaching it to a small molecule of carrier DNA, and then replicating this mod￾ified DNA thousands or millions of times through both an increase in cell number and the creation of multiple DNA-BASED INFORMATION TECHNOLOGIES 9.1 DNA Cloning: The Basics 306 9.2 From Genes to Genomes 317 9.3 From Genomes to Proteomes 325 9.4 Genome Alterations and New Products of Biotechnology 330 Of all the natural systems, living matter is the one which, in the face of great transformations, preserves inscribed in its organization the largest amount of its own past history. —Emile Zuckerkandl and Linus Pauling, article in Journal of Theoretical Biology, 1965 9 306 8885d_c09_306-342 2/7/04 8:14 AM Page 306 mac76 mac76:385_reb:

9. 1 DNA Cloning: The Basics copies of the cloned DNA in each cell. The result is selective amplification of a par ticular gene or DNA segment. Cloning of DNA from any organism entails five gen- eral procedures 1. Cutting DNA at precise locations Sequence-specific endonucleases(re- striction endonucleases) provide the 图源身 necessary molecular scissors 2. Selecting a small molecule of dNa Paul ber Stanley N. Cohen capable of self-replication. These DNAs are called cloning vectors(a vector is a terial cell to another. We also address dna cloning in delivery agent). They are typically plasmids or other organisms, a topic discussed more fully later in viral dnas the chapter 3. Joining two DNA fragments covalently. The enzyme dna ligase links the cloning vector and Restriction Endonucleases and DNA Ligase DNA to be cloned Composite DNA molecules Yield Recombinant DNA comprising covalently linked segments from two or more sources are called recombinant dnas Particularly important to recombinant DNa technology is a set of enzymes (Table 9-1) made available through 4. Moving recombinant DNA from the test tube to decades of research on nucleic acid metabolism. two a host cell that will provide the enzymatic machin- classes of enzymes lie at the heart of the general ap- ery for DNA replication proach to generating and propagating a recombinant 5. Selecting or identifying host cells that contain DNA molecule(Fig. 9-1). First, restriction endon- recombinant DNA cleases(also called restriction enzymes) recognize and cleave DNA at specific DNA sequences (recognition se- The methods used to accomplish these and related tasks quences or restriction sites) to generate a set of smaller are collectively referred to as recombinant DNa tech- fragments. Second the dna fragment to be cloned can nology or, more informally, genetic engineering be joined to a suitable cloning vector by using DNA lig Con Much of our initial discussion will focus on DNA ases to link the DNA molecules together. The recombi- ing in the bacterium Escherichia coli, the first or- nant vector is then introduced into a host cell, which ganism used for recombinant DNA work and still the amplifies the fragment in the course of many genera- most common host cell. E coli has many advantages: tions of cell division. its DNA metabolism (like many other of its biochemical Restriction endonucleases are found in a wide range processes) is well understood; many naturally occurring of bacterial species. Werner Arber discovered in the loning vectors associated with E coli, such as plasmids early 1960s that their biological function is to recognize and bacteriophages (bacterial viruses: also called and cleave foreign DNa (the dNa of an infecting virus phages), are well characterized; and techniques are for example); such DNA is said to be restricted. In the available for moving DNA expeditiously from one bac- host cell's DNA, the sequence that would be recognized TABLE 9-1 Some Enzymes Used in Recombinant DNA Technology Enzyme(s) Function Type ll restriction endonucleases Cleave DNAs at specific base sequences Joins two DNA molecules or fragments DNa polymerase I(E. coll Fills gaps in duplexes by stepwise addition of nucleotides to 3 ends Reverse transcriptase Makes a DNA copy of an RNA molecule Polynucleotide kinase Adds a phosphate to the 5-OH end of a polynucleotide to label it or permit ligation Terminal transferase Adds homopolymer tails to the 3-OH ends of a linear duplex Removes nucleotide residues from the 3 ends of a dna strand Bacteriophage A exonuclease Removes nucleotides from the 5 ends of a duplex to expose single-stranded 3 ends Alkaline phosphatase Removes terminal phosphates from either the 5 or 3 end (or both)

copies of the cloned DNA in each cell. The result is selective amplification of a par￾ticular gene or DNA segment. Cloning of DNA from any organism entails five gen￾eral procedures: 1. Cutting DNA at precise locations. Sequence-specific endonucleases (re￾striction endonucleases) provide the necessary molecular scissors. 2. Selecting a small molecule of DNA capable of self-replication. These DNAs are called cloning vectors (a vector is a delivery agent). They are typically plasmids or viral DNAs. 3. Joining two DNA fragments covalently. The enzyme DNA ligase links the cloning vector and DNA to be cloned. Composite DNA molecules comprising covalently linked segments from two or more sources are called recombinant DNAs. 4. Moving recombinant DNA from the test tube to a host cell that will provide the enzymatic machin￾ery for DNA replication. 5. Selecting or identifying host cells that contain recombinant DNA. The methods used to accomplish these and related tasks are collectively referred to as recombinant DNA tech￾nology or, more informally, genetic engineering. Much of our initial discussion will focus on DNA cloning in the bacterium Escherichia coli, the first or￾ganism used for recombinant DNA work and still the most common host cell. E. coli has many advantages: its DNA metabolism (like many other of its biochemical processes) is well understood; many naturally occurring cloning vectors associated with E. coli, such as plasmids and bacteriophages (bacterial viruses; also called phages), are well characterized; and techniques are available for moving DNA expeditiously from one bac￾terial cell to another. We also address DNA cloning in other organisms, a topic discussed more fully later in the chapter. Restriction Endonucleases and DNA Ligase Yield Recombinant DNA Particularly important to recombinant DNA technology is a set of enzymes (Table 9–1) made available through decades of research on nucleic acid metabolism. Two classes of enzymes lie at the heart of the general ap￾proach to generating and propagating a recombinant DNA molecule (Fig. 9–1). First, restriction endonu￾cleases (also called restriction enzymes) recognize and cleave DNA at specific DNA sequences (recognition se￾quences or restriction sites) to generate a set of smaller fragments. Second, the DNA fragment to be cloned can be joined to a suitable cloning vector by using DNA lig￾ases to link the DNA molecules together. The recombi￾nant vector is then introduced into a host cell, which amplifies the fragment in the course of many genera￾tions of cell division. Restriction endonucleases are found in a wide range of bacterial species. Werner Arber discovered in the early 1960s that their biological function is to recognize and cleave foreign DNA (the DNA of an infecting virus, for example); such DNA is said to be restricted. In the host cell’s DNA, the sequence that would be recognized 9.1 DNA Cloning: The Basics 307 Paul Berg Herbert Boyer Stanley N. Cohen TABLE 9–1 Some Enzymes Used in Recombinant DNA Technology Enzyme(s) Function Type II restriction endonucleases Cleave DNAs at specific base sequences DNA ligase Joins two DNA molecules or fragments DNA polymerase I (E. coli) Fills gaps in duplexes by stepwise addition of nucleotides to 3
ends Reverse transcriptase Makes a DNA copy of an RNA molecule Polynucleotide kinase Adds a phosphate to the 5
-OH end of a polynucleotide to label it or permit ligation Terminal transferase Adds homopolymer tails to the 3
-OH ends of a linear duplex Exonuclease III Removes nucleotide residues from the 3
ends of a DNA strand Bacteriophage
exonuclease Removes nucleotides from the 5
ends of a duplex to expose single-stranded 3
ends Alkaline phosphatase Removes terminal phosphates from either the 5
or 3
end (or both) 8885d_c09_306-342 2/7/04 8:14 AM Page 307 mac76 mac76:385_reb: